Description :
From Genome Similarity Track
Location :
Scaffold_772:7580- 9808
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_772-fgenesh-gene-0.1Pro-apoptotic serine protease nma111

Sequence
2228 bases(100 bases per row)
CGCGACGGGCTTTGTCGTGGATGCCGAGCAGGGGATAATCTTGACCAACCGCCACGTCGTCGGCCCAGGCCCCATCGTAAGTGCATTGCCAACTCTCGCG
ATTGTTGCAGAATCCTAAATCGTTCGTGTAGGACGCCGAGGCCGTCTTCCAGAATAATGAGGAAGTGCGCGTGATCCCCATTTATCGCGATCCAGTCCAC
GACTTTGGTTTCTTCAAGTACTCTCCAGCAGTACGATTTGCGTCTTGTATCCTTCTCTACACCCATCAAGACTCACAATGTGGAAAAATGGTGGTAGGAT
GTCAAACATCTATCGGTGCCATCGCTACCGCTCGTGCCCGAGAAGGCCAGCGTCGGCACGGATATCCGTGTGGTCGGTAATGATGCGGCCGAGAAGCTCG
CGATTGCAAGCGGCACGCTCGCGCGGCTTGATCGGGATGCACCCAACTATGGCTTCAACAGCTACAACGACTTCAACACGTTCTACTTTCAGGCATCGTC
TGGTTCGTGTCGCCCGTCTGATAACTGGAGCCAGTTATGACACTCATCCACCTCTGGCGTATTCCCACAGGTACTACGGGTGGATCGTCTGGATCGCCTG
TGTTGAATCATGATGGCGAAGCTGTTGCGCTGAATGCCGGTGGCAAGATCGGCACGTCGGCCTCTTTCTATCTCCCACTCGACCGTGTGAAGCGTGCGCT
TGAGTTGATCAAGCGTGGTAAAGAGGTGGCACGTGGCACCATTCAGACCGTTTTCCACTACAAGGTACGTCTGCTTCATTTGCACCGGCGTTGTCCAGTC
AGCGATCACTAACAGAAGTCGTATCCATGCCTGTCTAGCCGTTCGATGAAGTGCGAAGGCTGGGTGTGTCTGCATCGACCGAGTCGCTCGTGAGATCGAC
TTCTCCACTGGAGACAGGCATGCTCACTGTCGCCGAGACGGTGCCCGGTGGGCCGTCCCATAAGAAGCTCGAGCCTGGTGATGTCCTCGTGCGGGTCAAC
GGCGAGCTGATTACCCGTTTTGTCCCACTCGAGGCGATCTTGGACGACCACGTTGGCAAGACGGTACGCATAATAGATACAGCTAGTCAGCCCCTAAGTC
TGAGTACGATTATGGATTTGTTTTCAGATTGAAGTGGAAGTCGAGCGTTCCGGAGAACTGGTCAAGACGACGATGGATGTGCAGGATTTGCACGCAGTGA
CGCCGTCCCGCTTCATCGAAATTGGTGGTGCTGTCATCAACCCACTCTCGTACCAGCAGGCGCGCAACTATGCGCTCGTGGCTGGCGCACCGTACGTCGC
GGACCCCGGCTACTTTTTGCAGCGGTCCCACATTGGTCGCGGCTCGCTCATCAAGTCAGTGAACGGCGTGCCGACGCCCGACCTGGATTCGCTGAAGAAC
TACCTCGCGACTTGTGTCGATGGTCAGCGTGTTGTCATCAAGTACTCGATGCTGGCCGACAAGTCGGACCGTGTGGAAGTGGTCCATATCGATCGGCGCT
GGTTCCCGTTCTGCGAGTACGTGCGCGATGACAAGGAAGGCACGTGGCACTGCACAAACCTGGACGATTTGCCATTGACCAAAGCGCCCGACAATGCACA
GGACGCCACGACTGATGCATCCAAGAAGAACGGTGCAATCGGCTCCACAACGACACTGCGGGGAAAGAACAAGATCGAAGCCAAGCTCGCGCATTCGCTC
GTGACGGTCGACTATGATCGCCCGTTCAGCGTCAACAGCTTGGCGACTGCCAACTACCGCGGCACGGGACTCGTGATCGACGCCGAAAAAGGGCTGGTCG
TTGTGGACCGCAATACAGTCACCGACTCGCTGGGTGACGCCATGGTCACGTTTGCCAGCACAATCGTCGTGCCGGCGCATGTGGTCTTTGTGCACCCGGT
CCACAATTTTGCGATTGTACAGTACGACCCCAAGCTCATTGGCTCGACACCCATCGAGAGTTGCACGATCTCCGACAAGAAAATCGCACCATCGGACCCG
GCGTGGCTCGTCGGATTAATCAGCAGTGTCGGACGAAGCGGCCACTCAGACTTGGTCTCTCGTGAGACTATCGTCTCGGGCGTCAAGTGGATCGCGCTGC
CCATGCCCAACCCGCCTCGGTACCAAGAACACAATCTTGAAATGGTCGCGCTTCAAGACGTCGTCTCGACCGAGGGCGGCGTCATCACTGACCCGGAGGG
AGAAGTACAAGCCTTTTGGGGATCGTTC