Description :
From Genome Similarity Track
Location :
Scaffold_231:758- 8283
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_231-snap-gene-0.24Protein containing a histone methylation DOT1 motif
Pytap_DAOMBR444maker-pag1_scaffold_231-snap-gene-0.25Gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_231-snap-gene-0.26Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_231-fgenesh-gene-0.9Salicylate hydroxylase protein
Pytap_DAOMBR444maker-pag1_scaffold_231-snap-gene-0.15Malonyl-CoA decarboxylase (MCD)
Pytap_DAOMBR444maker-pag1_scaffold_231-snap-gene-0.16EF hand-containing protein

Sequence
7525 bases(100 bases per row)
ACGCTGTACACGCAGTCAGGATTGTCAGAGTGATAAcGGCgTTAGGTGGACGATGCGATGCGATGCGTATGTACTCACATGCACatAAAGCGTCGCTGTG
CCCCAGCTCATCTTGAAGTTATAGCTCTTTACGACCTCGAACAGAGCCGACTGGAGGATGTGAGAGGTCGAAATGAAGTAGGCGCCTTGCTTCAGCTGTT
CTGCGGCAAGCGATATTTGACTCCACTCCCTATGGATCAGGCATCCGCACCGGGTGAAAATGAAACTTCGGATCCGATCTTTTTGGGAGACGTACCTGTC
GTTAAAGCATGTACCATGGCAGAACACAACATCACCATCGGCCCACGACTTTGTCAGCAGATCGGCGCAAATGAACTCGACATCCGTTTTGATGGCCTTC
GAGTGATTCTTCCTCAAGCTTACAAGACGTTTCTCTGCACATGCCACAAGTGGCTGCAGCGCTTCGATCCCGATGGCCTGATCAAAAGGATGCACCAAGC
TCGCGGCgACGACAGCTTTGCCTGTGCCTGAGCCCTACAATAGTTCGTGGCGTTAATATCCGATAATATGACCGAAGGAGGTGTGCATGGTACTGACCAG
ATCATAGAAAaTCGGATGCTCCGGAAGATTTGGCGCGACGTATCGAATTACTTCGGCAAACGGGAAGAAGAGGATCTCTCCATAAATCTgAGGGCACCAT
GCTAGTTGAGAGAATTCCAAGACGTACAATCCATCGGAATACTTCAGAACGCACGTAAGACGACTTGATGTTGTTGGAGCTCTCTCGTGCTTCCTTGGAT
AGTTCCTTTCCATACTACGCTCGGAGAGTCACCATCAGGTTGGTTCTCATAGTTATAAACGACTAGTACAACTCGCACCTCCGCTCCATACCCACGGTAT
GCGTCTTCAAATGCAATGAATGGCTTCACAAAGAGCATACCCAGAACAAAATCTGCAACATGTAGCTCCGCAATCTCGTCTCGTGCAGCCTGCTCATTCC
ACGGGTTTCCCTTCAGTACGATCCCGCGACACTACTTACCAGACATACCGCAGGCACCAGGCGCTTCATTCCTTGCAGTGCATCGCTCTCGCGCAGCTTT
TGAATGCCCTCAGGCGTCGACAGAAGAGATCTGACACGTTCCCGGATGCTCAAAGCTCGATGTGCTGCCTACGAGCCCACACACGACTGTGTCAGCATTC
AACCACACGGTTTGTAGCCACTGCCATCTACTACCTGCTGCCATGTCGCGTCGAGGGGCTCGAAGTCTTCAAGACGCGgTGCAAGACGCGCGAGTTCCGC
GACGTTGTCATTCAGGTCCGCCATGTTGCCAGGTCTTCCACACAACGAAAATGATGCGCAAGGTGAATTCGTACCCTATTCTGGCATCGAATTCGGCTGA
TCAACCTGTTATTGGTTTCGTGGTCACTTTCGCTTTAGTGACATGGCTACAGATCTACCATGGCTGTCAGGGCCGTGTCGGGCCATTGCCCCCATTGCTT
TCATCACCCTCAGTCGCGTTGTTCTTGCTCAGTAGTAGCGTACAGTACGCTTGAAGGGCCTTCTTCCCACTGTTCAGAACGATGTCTCGAGTCTGCGTGT
ACATTCCGATCAAATTTCACGAGATCCCATGGAATGGATACTCTCTGCTTACCTCGTTCAGCACCGAGAGTTCTCGTCGTGTGTCGTGCTGAACGCGTTG
GATGTCCTTGAGGCATTTGTTTTGTTCGACATGGGCTTCCAGAGCAAAGTTCTTCTGATTTTtCCGTTCGTAGCTGTGTAGTTTTGACATGTTAGGAATG
AGCAGATCATCCTCCCGTGCTCTTGGCACGTACTACTTGTGGAACGTGGCTTCGCCGCCAACGGGGCAATCTGCTAACGGCGTCGTGCGCAAGAGATAGC
TGGGCTTTTtGAAGTTCTTTCTCTCGACGCCAAGATACTCCTTCATAAGGGGACTGAGCTGCGACGCATTGAAAAAaGTGCGCAATTGGTGTGTGCGGTG
TAGTCGAGAACCTCCAGACTCGGTAGATCCACCCGGCGTAGTCGCCGACGAGTTCATCAGTGGGCGGAGGCTTGCAGTGGGGAGAGAGAGAATCTTGTCG
ACGCTGTTTTCACTGACGAGCTGTTTGAGTAAGTACGACTCGCTCGCGCTTTTCCGTATCGAAGGTGTGTCAGTCAAGGCCAAGGACGACGTCGAGGCTG
AGCCACCCAGTCGAGGCAACAATGCAGATAAGTCGGGCATACTCTTGGTACTTGCGGCTTCTGCTTGCTGTGCGGCGATCAAGTTCTGCTGATGCTTGGC
CCTGAAGGCAATGGTTTCGTCGGCCATTTCCTCAGGAAAGTATTGACGTCGCATGCTTAGAACAGACACAGGGCACAGCCGAAGGCCCAATAGGAGCTGT
CCAATGAACAGGAAAACTTCGCTTTTGAAATCGGGCGAGTATAGATGCCGAGACCCCGGAAACAAATAGTGAAATCCCCAGCACACTCCACTGGCGATCG
CGTAGGGATACACGCGGAAGATATAGTCGCTGTTGTTTGTACGGAGAGTTGATAGGATCTTGACATAACGAGCGCTCACGATATCAACGAGTGACCGTTG
TTGTACTGCAGAGTTCTGTGCCACACAACACCGATAAACTGTcGATGCCATAATCCCACCCTCAAGCCCCCCACGTACCCGTTGGAAAAATTGGCAAAAC
ACCAGCCAAAAGATGTCTTCAAACAATGAGCATGACAACTCGGAGAGCAAGAAGCGCTTGAAGTTCTTTTTGCCATGAGAGATTCGCATGCGTTCGCACG
TGTGTTGAAGGAGCAGCTTGGCGTTCACTGGGATATTCGTCGTCGACTGCTGTGTTAATGTTGGGGgATCTGTTCCATAGTAATAGTTGTCCACGGTGCG
TGTGATGTGACCTTCAATGCTTGCTTGTAGTTGCTTCTCGAGATGCACTCTGGTGTTACgCCGGCGTTCACTCTTCTGTAGCTCGGCTTTGTTCTtCTTT
AGCACTTGCTGCAACAGCCTTCAGTGTCAGTTTTGCCATTGTAAACTaCCATCACGCACTCACCCCTCGTGATCTGCTTTTCTCGTCCGGTCCAAACAGT
CTCTCCATCATGGCTTGGTTACTAGGTAACGCCGTCGACGACACCGTTTTTGCGCGATTACTTGTGCTAGCACGACTCTCGTAGGGGTCTTGGAGCCCAG
GTACCATCTTGGAACAATAGTTGGCGTTGACTTTCAAGTCGCATTCGAGTCCGAAGTTTCTGTCGTTGGCAAGCGACTGCAGCGCGTCCAGCCGCGAAGA
AATAATTCCTATCATTTGCGCTGTGATTGCTTCCTTCTGGTTCAGTGATTGCTTCATCTCTAGGGACTCATTGGATTCATCCTTTATGCCGCCGTGCACC
GCTGCCATGGCCATTAATCGGGTGGCAAAGAATCACTACAGTGAAGGCGTGAGGCTAATTTTGACGACGCATGGAATCAATACAAAGTTGTATGAAGGAG
TGCCGCGGGATCTACTGAGCGATGTAGCTGTGTATTTTGGAATCAAGTGAGATCTCAATACGCAGCGAGAGCCCCCACAATTTTCAACAGCCTACTTCTT
CGCTACAGCGTAGGCTCACGAATGCAGTCCGAAGCGGATGGTCAACTTCAAATTAGACGCATGCCTACACAAATGTAGTTAGATTGTTTCAGACGATGGC
TTGAGCTTTCGGAAGAAAAGCTGCTTCACACCATCCATCGTCATTTCTGGTGCAGACAAGAACAGTTCGAGATTCTCGGCAGACCACTGCGCCGGAGGCT
GCACTCGAGAGAACATCTCTGCTTCAAACTTGGCGATCGCTGCATCGGTATCACTTCCCATCTTGGCAGCCTCAGCGATTTGATTCGCAAGTTCGAGGGC
GTCTAGCATCGCCATATTAACACCTTCACTTGCGCATGGCGACATCAAATGGGCAGCGTCACCAATGAGCGTCGCGCCAGGGCTGTGCTGCCACTTATGC
CCAACTGGGAGCGCATACAGAGGCCACTGCTGAATACGAGAACCCTGCTTCTtCTTAGCTTCCACTGCCACTGTAGCGAGCTTCTGCAATCGAGTGTCCC
AGTTGTGGTAGAAGGCGCTCACAAGAGTTTTCAGTCGACTGAAGTCGTCTTCAGCATCCACGATCGCATCATGTTGACGCCAATCAACTTGCGACTTGAA
CCCGAGATACACACGAACGACGCCATGGGCATTCCGCTGAGCAATCAGAATGTTGCCGCCATCAAAGGAGAACAACGAGCCCTTCCCGACGACGTCTATC
AAATCAGGGAAGCGCGAGTCAAACTCTTCAATCGCACAATCAAGGAATGTCGCTCCACAGAACTGAGGTGTCTCACTCGTGATCATTGGCCGCACACGCG
ACCATGCGCCGTCTGCACCcACCACCATGTCGGCTGTCTCGACAGATCCaTCTGCAAAATGCAGTTCAATGGTGTATTCGAGTCGTGCAACACTCAACAG
CTTATGATCCCATCGAATCGTGTCCATGGGgATCGCcTCGAGAaGCACTCGATTCAAGTCTCCACGATCAATTTCGGGgTtGTATGCGTCGCTCTCGAGC
GTCTCTGTGCCTTGgTTGTGGAAAAGCAGCTCGCCCTGATGGGACATCGCTCGTAGTTCCTGGCCTTCTGGCCGAGCCAGTTCCAGGAAGCGGTTGAGTA
GCCCCGCCGCCTGGACCGCAGCTAGTCCGGTCTCCTTGCCCAAGTCCAGACTCCCACCCAGGCGACGCGCGGTCACGCTCTTGTCGGCTTCATACATCGT
GACAGTCCATGGCACGTGGCGGCCTTGGCGCTGCAACTCTGCAGCCTGGCGGTGGAGAACGTTGGCCAGGTGAGCCCcGCGGGgCCTGCGCCGACAATGG
CGATATGCAGAGGGTCTGCCATGAGCTTGGgAGGGGTAATAAGCAAGTGGGGCTTCCGCTAGTTGGATGGCCCCcGTCCATGGGACTGGACTCAGTCCAC
TTCAAGGTGATGGATGTCAAGAGTGATGGACACTGGGGgTACGATGTACCCcTGTTCCCTTGTTCGGCTCCCTCcAACAAGGGACCCTTATCATCTTGAA
CCTTGCCACGGGGGACTCGCAGACACGCAGAAGCAGCCATGATGCGGGTGGCGCTCtCACGCGtCATGGGGCGTCGGGGCCGCGCCCcACGCGTCCTGTG
GCGGCCCTTCCACGCGACAGACGTCGGCGATGGACAGCGCGTGCCGCTGGCGCCGGAGGACTCGACGCCGTCGACGTTCCTACAGTCCATCGACCTGAAC
AaCCCGAGTTCCGATGATCGCCAGAGGCTGTCGAAGCTCATCCAGGAAGTCGTGCAGACCAAAGCCAACACAGGCGGTGCGTTCATGCGGTGCGAAAGCG
ACTGAGGGATGTGCTGGATGTGACAATGTGTTGTGCGCGCGGAGCAGACTTTGTGCCCCGCGTGATTATCGGAAACCTCTGTGCCAAGTACCGATCGCTC
AACATCGACGAGAAGAAGCACTTCCTGCTCATCCTGGCACGGGATCTTCACGTCGACATCTCGTTGGTCGAGCGGAGCCTcAACtATTTtGCGgAgAACT
TtGCGCACGTCCAGCGAGACGCTGAGGCGCCAGGGGAGAGCGAGATCGAATGGGAGCATGAGCAGATCGAGCGGTTCCTGCGCACCTTCCGCAACTTGCG
TACGTCCCTCACGCCGCTCTACGAGGTAGACAAGACCACAAGACCCATTGGATTCTCAAAAAGCTGTTGACTGACTTGGTCTTTTtGGAATAGACCTTCT
TTCAGCAGGTGCTTTCGCAGCGTGAGGGCGGCATGCTTTTCCTTgtCCAGATGCGAGCCGATCTGCTTCAGGTGCTACGGAAAAACGCCGATCCCGGCCC
GGAAGCGTCGGCATTGCGCTCATTGGATGTCAGTCTGAAGGTGAGACATAGCTGACTGGGTCTTTCGATCCCGTCcTTCCTTCTCAGTGCTTCTtaTtGC
TGCTTgTAGAACATCCTTGCTTCATGGTTTAGTGTTGGTTTtCTTAAACTCGAGCGCGTCACGTACGAGAAGTCGCCAGGACAACTCCTGGAAAaGATCA
TCCGATATGAAGCAGTTCATCCTGTGGGGACAATCATTGAGCTCAAGCGACGACTAGGACGCGGGCGTCGTTGCTTCGCCTTCTTCCACCCAAGTGTACC
TGATGAGCCTCTTGTCTTCGTCCATGTCGCCCTGGTGAAGGAGCTAGCTGGAAGCATGCCGTTTATAAAGGAaGAaaCGGAGAAGATGGATGATGAATCC
CAAGCGCGAGCTGCTATATTCTACTCTATCTCTTCAACGCAGAAGGGTCTTCAGGTGAGCAATCGAACATCATAAGTATGGTGACCAAGTCTGACGCACT
GATACGcTAGGGAGTGGATCTCGGAAACTTCCTAATCAAAGAAGTCGCGAAAGAGTTGACGCGCGAACAGCCCCAGCTGCGGATCTATTCAACGCTCAGT
CCGATCCCAAACTTTGTTCCTTGGCTCGAGAGCCATCGCAACAACGATCAGCTTTTGCATCCATATCCAAGTGAAATGAAGGGGTTGCGCCAAGTTCTTG
GAAGCAATGCGGCAACTGACGTCGGAGTTTTGTTAGAAGCGTTGTCCGTCGAGAATTGGCATGAGAAAGACGATCTGGCGTTGGCTCTCAAGCCCATTCT
CCTACGCCTCGGTGCTCGCTACATCTACCAAGAGAAAAAGCGTGGAAAGGCACTGTGCCAAGTTGCCAACTTCCACATCCGCAACGGAGCCATCTTTGAG
CGCATCAACTGGCTCGGGGATCCTTCGGCCAAGGTCCGTAATGACGACATGTCCTCAAAAAGCTCGATCCTCGCTAATGCCTCTTTCATCTGACTGTAGG
GCCTTCGCCAAAGTGCTGGGATGATGGTCAATTACAAGTATGACCTTGCCCGCGTCGAGAACAACAACGAGAACTATCTGTTACAGAACATCATTGCCAT
TGGCGACCAGCCCAAGCATCTGTTGGAGCTGCCATGAGCTGTATCCCGTCGAAAGCTCATCTTTTTTTtGTtCTGGTAATATGACGCGCTCTTTTGCCAC
CACATACAGATATCGTCGGTTACTTTGCCTACAGGATCAGAACACGCGGCTTTCCATTCCAAGCGTCACCCTCAAGACGTTGTGTTGGACTTGGCATCCT
CATGGTGCTCGCTCAAGACGAGATCGATGCGTGCCGCGAGGCGTTCCTGGCGTTCGACAAAGATCGGTGAGTGCAGACTGTGGTGGCCAGAGGCGCTCTG
TCTATGGCACACGCGCCACCACTCTCATGGACATCTCGGGTGTGCCTGGCCCTTCTGTCATCGCTCGCATTTGTTGATGGCAGATCACTGATAAGAGATG
ACGTGGGCATGCAGGAGTGGCACGATCGATGTGTGGGAGCTACGGCAGGTGCTCGAAGGTGCGATGCCGCGTTCTTGGATCCATCCCTGCGTGATCAAAG
GAACTCaCGAGTATGGACTGGTCGC