Description :
From Genome Similarity Track
Location :
scaffold_717:758- 6611
Transcript NameFunction/comments
g9971.t1 hypothetical protein PHYSODRAFT_552991
g9972.t1 conserved hypothetical protein

Sequence
5853 bases(100 bases per row)
AAGAGATGCCGGCCGACATTGAGCGCATCGTGGACCGCAAACTGATCAAGCAGCGCGTGCACTACTTCGTGGTCTGGAAGGGCTTCGGAGAGGAGAACAA
CACCTGGTATAAACTGCCTCCAGTCCTATGCAACATGTTCATCACTAAAAACCTATTTTCTGTTATTTTAATTCTAAACTTTTACGATACAGGGAGAGTC
GTATCGACTTGAAGGCTGATGGTTACTCGGATGTCATCAAGCGTTTCGAAGAGGGTACGGCTTCAGCTCCTGGCGTCAACCGTATCATAAGTATTTACTC
ATTATTTTATTTCTTTATCTGTTGCAGAACGCAAGAAGGAGTCGGGAGGGTCAACACCCCGCGGGCGCAGCCCTAGCCGCTCGAGATCCAAGAGCCCGGG
CAGGAGTAAGAGCCCTGGCCGTGCCAGGGGGCGTCGCAGTCGCTCTCGCAGCGCCTCAGTGAGTCGCAAGCTGCCCGTGGACAACAATGAAGAGGAGGAC
AAGAAGGAGAGTCCTGTTAAGACGACGACTCCCACGCGACGCAAGAGTCCCAGAAACGATGACGAAAACAACGGAAAGGAGACGCCTAGACGCCGATCCA
CCCGGAAGCTTACAACCGCGTCTTCGTCGCAGTTTGTGTCTCGCCTGGACGAGCAGAAGACGGACCCTGTTACGGATGAAGAAGATGACTCGCTGCTCCT
CCGATCGACCATTGCTGGGTTGTCTCCGCAGGTGCGGGAGATGGCGCCGTCTGCCCCTCTGGAGGCTGAGACGGTTGTGCACAAAAAACCGGTGACGTTG
TCGTACGAGGAAGAAGAGGAATCGGTGCTACTGAAGCCGCAGAACACGAAGGAGACTGCCACCGACTCAAGCTCTACTGGTAGTCCCGTTCACAATCACG
ATAACCCCGCGCAGGGCGGTTTGATTGCCAAGGTATTGGAGAACGACTACATTGGATCGTTGCTCAGTGTAGCAGTCGTTGTTGGCTCTCTCACGGCAAG
CCAGATGCTGCCGCGTGCTGAGGAGGAACCCGAACTTTGGCGGAGGTGGCTGTCGTTCCTCATCCCTGTGGTGGCGCTGCTAACTTTCTTCCACCAGAAG
GATGCTCGCGCTTCGGCGAAGTGGGTGGCTACTGGTCTGGCTTGGCGTGCTGCTGCAGAGCTTCTGCTGTTGATCGGTGCCACTCCGCGTGAGTTCGAGA
CGATGGTTACTGGCTCGGCTATTCTAGCTAATGTGTCGTTGCTGGTTGCCATTGTCGTGATCCTTCGCAACGGCGAGCACGAGCAGTCCAAGGCTACACT
AGCGCTGCTGACGGTGGGCTCGCTGGGCCTTTTCCTTTCAGACAGGTATGTTGTTCATTGGAATGTGTCTATGTGTCAATGCTTAACGTGCTTTGCTTAT
CAGCTGGGTGATCTCCACTGAAAACTCCGAGCTGGAGTCGCGTGTTATCCTCATGTCGATGGCCGTTGTAAGTACTATTTCACCAACCTCACGTTTGTTC
TTGGATTGAATGACTAACGTTTTGCATCTCCAATAAAATTTCCAGCTGGCAATCGCACTGTCGCCTAAGCCGACAGTCTCCTGGGAGGATGAGGAATAGG
ATAGAGCGCCTCAGCTACCTCGACGCTGTAATTAGGAGCTTGTTTTTTCGCTGACTTCATTCTGAGGCACCGTTGTTGCTGCTATATGAATTTTATGATC
TCCATTGTTGCCGGCTGGCTGCGTTAGACTGCTCCCTTGCCGAAAGATTCTGTTTTGTATTTTCAACGGACCGGCAAGTAGATTACTCTAGCGACAGTGC
GAGATGCAACGTCTTGATCAGAAGCTGTTGGCTCTGTACGCTGACAACCGAATCGACATCGCCCTCGCGGTGCACCAGCTCTCGAATAACCTCAATCGTC
AGTGCGGCCGTGGTTCGAGCTCCGTGCACCCGGTGTTCGGGTTCTGACGAATACTCCTTCATAACCTTGTACAGTAGCGTCTGACGCATCAGCGACTCCA
GCTTTTCCTCGTTCACACCGGCAGCTGACTCAACGGCCAAGTTGTCCCAAAGTTCACCGTCATCGACGATGCAAGATCGCCATACATCAGCGCGCATCTC
CTCGTACTCCTCGGTCAGCGGGTCGGTAGCTAGAGTCTCTAACGCTTCGAGGGCCATCAAGAAAATATTGGTTCTGTAGTACGCAAACAAGTGAGTAAAT
AGTTTTCAGCACACAACAAAAGGCAGTACTTAATTACCTCATGGGGTCATCCTTTTCAGCGGAAAGAGCGGACGTCAAGCAGGCCTGAACCAAGTCTTCA
GGAGAAAGAGGCTGCGGGTTGACAGGGTCCTTCAACGGTAACTGGAGCAGCAGCTCTTGAATCTTACCACGGACAAGCTGCAAGATACAAACACAAACAC
ATGATTTAGTATCTACTCCCCCATTGCACTTGACCAACGAATAGCAAAACGCACCTCATGGTTGATTTCTTGAACCCTGTCGGGGTGAGATAGACTGGGG
GATGCAAAGGCAGCGATCTTGGCAATACTAGCCATCGTCTTGCGCTTCGGCAATGAACGCTGCTCGCCCTTGGCTTCACGCAGAGCAAGTGTTGCCACCT
GGTCATAACGCTCGATAGAGACGGCTGTCAACCAGCGGTACTTCCTCAAGTGGTCACGGCTCTTCATGAACTTGTGCAGTGACGGCGCAAAAATCTGCGA
GTGGGCCAACAGATACGCAATCATGGTCGCATTTGCTTCTTGCTGGCCTTGTGTCCACGGGTTCCGAACTTCACCGTTATACCAGCGGAAAATGAAGTTG
TCAAAACCCTCGTGCTTTTTGCAGTATGACTCCAGTCTCTTCGACGCAAGGCTCTTGGGGAGTTTGCCAAGCACACAATCCAACTTGGACAGATTCACCG
AGTCTTCTACGAACACCAAGAAAACCATACCCTCGAAGTACGCGTACTTCTTGCAGAGCTCTACGCACTGACTAAAGAGGTCCGCTCGCTTCCGCGTCAC
GATGCCGTCTTGATCAAAGTCAACTGCAATGTCGCTTTCTTGAGGTGTCTGAGTCGCGATGTAAACAAGGGGGTTCAGCGTCACGCGCTTCGTAAACGTT
TCCTCCTTACGCAACTCTTCTGCCTCCTCACTTGAAGCGAGAGGGATAAACTGAGCGTAGTTGTCAAGCAAGACCGTCCCTAGTCTCTTAATCTGATCCG
TGAGCTCAAAAATCTCAGCATATTGCCAGCGAATCTGCTTATCGGTCGCTCCCTGCGAGTATCCAGTCAAAACAGACAACCGCGAGATTTGACTCGCCAG
AACTTCACGCACTTCGCGTGAAAACGCCCAGCTTCCGGTCGGTGCGAAACTGGCAGCAGAGCTTTGCACAGGTGTGCAAAGCATACTAAGCATGGCACTG
CTACTTTCCAGCAGAGCGTAAAGGTATGTCGGGTCGCTCTCGCCAATCGAGGTGGCCAGGATCTGTACTTCCTCTCCCAAAAGCTGGAAGAGCTCGGCAA
TCTTGCTCACTTCGCAGTAAAAAACATCAAAGGAGTTGTAACCTGCGAGCCGAAGTTGCTCCTTCTGATAACCACGCTTTTCCACGGTCTTCTCGATTGC
GTGGAGGAGGAATTTCCCGGTCAACCGGCGTTGAATGTTTTGCACATCCGCTGACGTGTCTTCGTCAGAAGGACTCGAAGACAGAATCGAGGCCTGAAAC
TTGCTCAGAGCAATTGCGGCGTGCAGCTTCTCTTCGTTCTCTGTCAAATGGCGCTTCAGATCATCCGAGGTTTCAATAAACTCCCAGACGGACGTACAGC
GGCGCTGAAGGAACTCCATAAAGGCCACGTGACGATTCCTTTTCTCCTCCATCTGATAGCGCACTAGTTTGGGGGTGACGGAAGAAATATCAGCTTCACT
CGTCTGTGCATCTGTCTGTGGTGAGGCTCTGTCATTTCCTTCTTTCTCCCAACGCAGCCCCGACGACGACTTCGCATCCAAAATCTGGAAATCCACAGAC
ACGGCCGCCTGCGCGACAGCCCCCACATCCCTCGAGCTCACACGCAGCGCTGAAGCGGAGTTCGGATCATCTTGAAAGTGCTTCATAATCAATCGAACAT
AGTCCTCCACGCTCAAATTCTCGCCCAAAAAGTGAGAAGACTCGCTTGTGTAGTAGCTCGCTTCTTCATGTTTTCGGCGGGTCCTCTCCACGGATGCCTC
GGACGGAATTGGAGCCGCCAAACGCTCCAGTTTCTGCATATCGGACGCCGTGGCCACACACACTGATCCACTCTGCGACTTGACGTCATCGTTCATGAGC
AAAAACGACACCGATCCCTTTACAGCGTTGTTGTCAAAAGAGCTCTGGTCTACGCGAGCTCCAAACGCCAAGGCCAGTCGGCCTTGAGCACCTTGAAGCG
GGAACGCAGCCGAGCGAACACTAGTCTGCCCAACTTGTGGCAAAAGAATAGTAGAAAACTGGATCGGCTGCATGTGCGTCCACACCAGATACAAGGCGCC
ACGGGTGATGGAGAAGCTTTCAACCTGGAAGAACCGACTAGCAGCCTGTTCGTCAAACGATGGCTCAAAATCCAACACACACGCCCACTCCAGTTCCGGC
GCCGCATCACCATCCACCGATCCGAGGGAGAACTGAAACAGCGCATACTTGACCTTAGCGTTGGTGCCAGCACGCGACGAAGAGCACACAAACGCAACCA
GAAGAGCAAAGCACGTCTCCTGAACGTACGGCATGGAAACAATGTACACCTTCGCCAGATGGGTGTCCGGGAAATTGTCACTGAAGTAGCTGATTGCCAC
GCGGCTGGCATCAAAATGCCACTGAGAAACGCACGAGCAGTCCATGACGTCTCCAGTGCTAAAAGTGCGTCGCTCCATCATGCCGTCCTGGAACAGCACC
AGCATATCCGAAGTCTCGTCCACTTCCCCTCCACTGCTGCTCATGGAGACTGCATCTCCCAGTGACGAAGGGAGCACCCTCAAGCACTTAATGGGCTGGT
TCACATCCAGTTCTCCGCCATCTGCTCCTGACTTCGACGCCGTCGACGAGAAGAAAAACTGCGATACGGACTTGGTGATTCCAGATAGAAACCCTGCACT
CTGCTTCTCAAAAGCTCGAACTCGAATGCGTCGGTCTTCAACTGCTACTTCCCACACGTTGCCTTGGTTACTCCAGCACACCAGTCCAGTGGCATCTTCG
TGAATATCTTCATCTTGAGCTCCTTGAGTCGCCACCATTGCAGCATTAGGATGAGTACTAACTTCTTCATTAACCCCAAGGGGGATCTGCACACTTAGCG
GTACACTCTCGTACGGGAGCTCAATATCCTCCCAAAAGAGCACAATGCCGCTCTTGCCCACCACCATGAGACTCAAACTCTGGCTGTAAAGAGCAAAGAG
GAATGGGAACAGAATCTCCTCAGGCTCCAGCTCATCTGGCAATTGGAGGGACACCACTCTACCCCTGTCTTGTTGCCACAGCAGAATTTTCGTCCGCAAT
GGGAAGACGTAGTACGGGATCCATTGACGGCCGCTGCGATGACGCGCCGAAGGCACCGACGCCCGACAGCAGCGGATCTGATGACGCTGGTGACGTGGCA
ACTGCGGCCACTCCTTGCGCAGTTCTTCCAGCACTTGGGGCGGCAAACTGCCGCCTTCCACGATCGTGCAGCTCCTCGTGTCCACCAGCAACGACGCGTG
TTCCTCAGCGTCAACCTCGCTGCCCGAACGTGGTGCGTACAGAGCGTCCCAGTGCTCCAGCCGTTGGCGCTTCAACGTGTCCGTGGCCAGCAGCCCCGAG
CCCACGCGCTTGGCCGGCACATCCACGAACTTGCGGGCGCGGAACATGGTAAT