Description :
From Genome Similarity Track
Location :
Scaffold_3:75797- 79749
Transcript NameFunction/comments
Physo_329063Hypothetical protein
Physo_494190kazal serine protease inhibitor PbraEPI2
Physo_558663Hypothetical protein

Sequence
3952 bases(100 bases per row)
CGCTGGCTACTTCGAAGGACGACGAGCTGCTCGTCGGGTTTTGCGGTGCTCCGATCCTGAAGTGCGCGTACCTATCTGTCCGCGGCTTCTGAATCGCATC
CGCGTACTGTACCCATTTGATGCGCTGGTGACCAGCCTGAGGTGCAGGCCGTAACTTTCATTTTTTTCATTTTTCAGGTGAGGTATATTGTGTTCATTTA
GCGCAATCCTGCCCTAACGATCTCCAACAAGCAGGTCGTAACTTAGCCTTCTCTTGCAAGCTATCGATGCATGCATCGCGACGCGCAAAAACTACCCTGT
GAATCTCGTTCTCATGAGCTCTCCACAGCCCTATCTGTTCGTGGCTTCGGAACTGCATTCCGCTGCTGGGTGTCGGCACTGGCATCGTGGACTGGTTGCC
TCTACTGCGAGAGCGTCTCATAACACGCTACGTGTGAAGGGTTGGAATGCAGGTAGATCGCGAATTAGAAGAACCTTATTTTGCTGCATGGCTGGCCTGA
CTTCAGCTTCAATAGCCGGGTGTTGTCCAGGACAACACCAGGACAACTTGTCCTCTTGTCTGCCGTCCTGTATCGTGATATGTTGGGGGCGTTGTTGTGG
CCCGACCGATATCTCCCTGGTAACGAGTCGCAACCCGATTACCTGGTGGTTGTTGCAATCTCAAACAGTCATGCCTTGTACATTTCGAGCGAACAGTCCA
AACAACAAATTGCAATGAACATGACTCAGTTGATACCTCAATTGGAAACCAAAGTTGTGACGGGAGAAGGAGATTGGTTCCGGCGATGCTTTTGAGCGAC
TAGAGCGGGCCAATTGAGATCGCAGTTGCTTCCTCCTGTTGGGGCGTAGAGCTACAATATCAACAAGTCGAATCTTGCAGATAGATAATATTGTCGGTAG
AAAGTCAAAACTTGGCACATTGTTGTCATTTGGCGTGTAGCACTTCGTCAATGAGAGCTGCGGCGGCAAAGCGGGCACGTTGTTCTGGTGCTAAACCAGT
CGATCACGCAGTCTTCATGGAAGTGGTGGCCGCACGGCAAGCTTACTTGGTCGGTTGCTGGATCTTCGCTTAGGCAAATGGAGCATAGCTGCTCGGGCGA
GGTTTGATCTTCCGAGTTTGTGGCCTCGATGAAGTCTTTCAACGCCAACACAGCGGACTGCCGCTGAATCTCTGCATCTTTCTGGGGCTGCGGGACCTCG
AGGAACGTCTCCAGCTCAGAGAAGATCGTGCACAACTGGGCCCACGATGAGGCAAAGCCGCCATCTTGTAGTCGGTTGTTGGTCTTGTAAACTGCCAGAT
CCGTGTACACGCCAAGCAGCTTCCGCACAAAACTCGGCAACCCCACGACTCGCTCGCTGATAACTTCGGGTTTGTTGGGTCTAATGTGTTTCCTCGGGAA
GGATGGCGAAATGGCGCGCCGCATCGCATTCGAAACAACGGCAAACGCTTTGCTAAGCCGCGGCCGTACGGGTCTTTTGTCATTTCAAGACGCGTGAGCC
AGCATGGTATCGTTATTTGCTTTTGAAACACTTACTTAAGTACTCTGGCGGCACGCTGCCAGGTTGGCGATATTGTCGCCGTCGTCGTTGCTGCCAGCAA
GTTGCTGGACGCGAACATAGCGCATTTGCACTTGACGCTACAGCTCTCTACAGTCCCAGTTTGCTCTGGAGACTGTCCCAGTTTGCTCTGGAGACTGTCC
CAGTTTGGTGCAGCAGAATTTTCCAATACATTCCTCCATACACTTTCGAGCACCATCACTCTGGCGTTTCAAACGCATCCCCACACAATATGCCCCCACG
TGCAGAATGGACTCGGCGCTTTCTCCCTCGAGCCGCGGGCGCGCCCCCCAGTCGACGCCTGGCATCGTCGCGCCGCACAGGAGACGCCCACCTGTCTGCG
CCTAAGCGCTCTCTCTCACTGCCCACTCTGTCCGTAGCGGTTGGGGCTGGCGCGGCGGCGCTAGCGCTGACTTCGCCCCCCGACAGTGCGCGGCGGCTTC
ACAGCACGGCACTATTGGGAGCTTTGGTCCTCCACGAGAGCGAGACGGCCGCGTCACTTGATGATGCTTTAACGCTGGTGGCTCAGTGGGGAGAGATTCT
GCGCCGTGGCGGGCTGCAGGCGGCGCAAGACGAGCTGCTTGAGCGTCTGCTGTCCTGCATCCTCCGCCTCGAAGACGACAAACAGAGCCAAGAAACGCTG
CGATTCCTGGTAGAACGAGGTGTTTTGCCTCTGCTTGTTCAGTACACAGCCTGGAACAAGCCCACGGAGCCGAGAAGACTGCAAGGTGCGCAGCGAAGAG
TATCCCCCCGATGCTCGGAAGTTCTAGGCGAGATCTAACGCCGTGTGCATGAATCTGCAGAACTGGTGCACAGCCTCATTAAGTTGCTAGATGCAGCTGC
AAACAATGGTCAGACAGAGTTACAACTGTCGCTGTTGACGCTGGCGCAGACGCTCGCCCACCTCCATCAACAGCGGGACGATACCGTGAGCTACGTTGAT
ATGCTGCAGCTCGGAGACGCTCTGGCCAAGGTGCAGCAATTGGCGCACCGAATACTGGAGGAGGGGGCAGACGCATCTCGAGCCTTTACGGTGTATCGCT
CGGAGCTAGCGGATTCAGAACGATCTCGAGTAGCGGAGAGCTGCGCCGCGCTGGCGGAGCTGTGCTCACCGGAAATGCCTGATTCTATGAAGAAGTTTGG
ACTGTGGGCACTGAGCACGCTTGCGCAAGCTATGGGCCAAGAAGATTCGAGCGCTCTACGTGCGCAGCAACTTGAAGCGGTATTAGGACCAAAATTTGCG
ACGATGTTGCTGGAGTTACCGCGATCTGGTGACGATGACAACTTACAGTTGCAGGCTGCTACACTGCTTGACAGGTTGCTGCATATTGCTCGACAAAACC
CGGCGTCTGTGTCGCGTGGTACGTACGAACTTTGGATGAAACAAATTCGCTATTGGACTGGGATAAAACGAGCCGAACGAGAGTCAAACTCTAAGAAAGT
GGTCTGGCAAAGACGGAAATCCGGCCGAATTGAGGACTATGATACCAAGAAGCGTGGCCAAAGGCTTCGCCTTCAACTCCAGCTGATTAGTTCACGCTGC
CTACGCACACTCACGGCGTCCCCGCAGAGTCGGCGTTACGTTTGTGAGTCTCCGACGACAAGAGCGGCACTTTTCGGCTTATCGCGTCAAATCCATGAAC
GGAAGCAAGATATCTGGGCTATGATTGACACGGACAACGCAAGGGACATGATGGAGATTCAGCGCCACTTGTCATGGACGTTTCGCAACATTTGCACAGG
CTTCCAGAGCGGCGCAATCGCTCTCAATTGCTTGTTCGACGCTTCTTGGACAGCCTCGCTGTTGCAGTCTCGCCGAGATCTGCCCATGTCTCGCTTCTTC
AGGGGAGTGAACGATCTCACCGACTTGCCCATCATAGGCGCGGAAGAATATGAGGCCAGTGTCGAGTTCGGTTGGGTCGACATTCTGACGGCTTGGAGTG
CTAGTGCAGACCACCAAGTGCGTGAGAACGCCATTGCGAGCCTGGTGCATCTGGCTGAGCAGAAGCAACCACCCCCGACAGGATTGGTGTCGGAGGAAGA
GGAAGAAATTCGCAACAAACAAGAGCACATCCTGCAGGCTTGGCTCACTAACATGCTCCAGCAAATGCGTCTACTTTCGAGCGGAGAAATGCTTGCAGTG
AAGCAGATGGAGGATATCGCCCACGTCTCGAAAGAATTGACTCCGGGAAATGAGCGGATTTTATTTAACCCTGCAGTGGTCGATGCTGGCACTTCAGCTT
TGGCAGTGCTGGTAGAGCATCACCACACAGAGTTAGTGCAACAAGGTATTGTGCCGTTGGTGGCTTTGCTGTCGGCAACTAGGGCAGCCACGCCTGCGCA
ACACACACAGTGCGCTCGGGTATTAGCGAACCTAGTTGCTAGCTATTGTCTT