Description :
From Genome Similarity Track
Location :
scaffold_25:757951- 759553
Transcript NameFunction/comments
g2949.t1hypothetical protein

Sequence
1602 bases(100 bases per row)
TTCTCTGACTACACACACCATTTTCACGCGCACGTCGCCAAGCACCGGATTTTGCGTAGTCTGCAGGAGCAACCAGCGCTTCGACTTACCTTTGAGCTCA
AGCGCAAGGCCATGAACATCCACGGCGCGACCACCTTCGACGTGGTGGCGACTCCGGCCCCGAAGGCAACCACTGGCGGAAAAAGTATGGTCTACAACGG
AATGGCGTCGTTCGAGAAGGACGGACACGCCCACGATTATTCGCTTGTGGATGGAACGGCCTACTACACGCGACGCCCGAAAGACAACTCGGCGGCGGAG
AACGAGTCAGGATGCCTTCCGTCGTACTCGGTTCCGCCTATCGAGAGCGTGTTGAGCGCCATTCACGGTGCCTCCACGGCCACCAACCTGATCAAGCCTG
GTGATCTACAGCAGAAATGTCCTGGTGGATCCGTGATGGTGTTCCCATTCGCAGGTGAAGACTTCGTGTTATGCTCGCACTCGTCGTGGTTCAAGGACGA
CGGGTTTAAAATCCTAGGCTCCGACCTGAACATCGACGTGAAGTATGACCAGACCACGCCTACGATTGTGGCTCCGCACGTGTCGACAGAGGCATTGGCT
ACGTGCGGAAAGGTTCCGTTTGGCGAGCAGATCATTCCGTCGTTGCCATCGCTCATGGCTCGGTCGTTTTCGGAGTGGGGACACCGTGCCCTGCGCGCGG
AGAAAGCTGAATTCAGTCTGTGGAATCTCATCACGGATGATGTTTGCGGCTGCAAGGGCGCTGAGCGATCGTGTGTGTTTATTGCTGGCCTTAGCTCGTA
CGAAGACCACGGTTTGACCGATGATGACCCCGAAGGCTACTTTGGCGATGAACTCAGCGACCACACACCGTGTTGTTCAAGCAGGAAGTTCATCACGCTA
GCCACGAAGGATAATTCCTGGTACGATCTTGTGTTCCAGCAACGCCTCGTTGATCTCCTTATTCAAGCGAGCGGTACAAGTGATCCCGCTACAGGAACGA
TCAAGGACACGATCATTTTCGGCCACTCCATGGGAAGCCTCACCTTGGCTGGTGCAATTGCAAACGGCAAGGCCATTCTTGACCCGTCGACGTCTTGGGT
GGCTGCTAGCACTCCAATGGAAGGCAGCATGGGCTCGAACTACATTCAACAATCGTGCAGTGGGTCACAAGATGGCTTCCTGGCCAGCCTCATCGACTTG
TTGGGCAACTGCCCTGCAAACACTGGAGAGTCGTCACTTGTCTACCAGGGCTCGGACCTATCTTCGCAGACGTTGAATGACGCGTATGTTGCTGCGCAAG
CCGCGTACACTGCGAACGTGGATGCCGTAATGTGCAGCAAAAGTTTCACTGGCTTGGTGACGCTGAAAGCTGCTATTTACGCGCTTGCGGGTGAAATGCT
GCCGCACCATTCTTCGGAGAACGATGGTATCGTGGAGTACGCAAGCTGCGCCATGGGTCTTCCCCTTGACAGCTTCGACACCTCGTATAAAAGTGTGCGC
TACGTGACTGAGCTGAACCACGTGGATACGTCGTTCCGGAACGGCGATGGCGTCTTCAGTGACGCGAAGAAACCTTTGAAGTGGTTTGAGTGCCTCCTGT
AA