Description :
From Genome Similarity Track
Location :
contig_23:75758- 77665
Transcript NameFunction/comments
g5982.t1hypothetical protein

Sequence
1907 bases(100 bases per row)
CAGACGGCGCCAACGACATGTGCACGCTCAACCACCTGCACGAGCCGGCCGTGCTCAAGAACCTCGAGCTGCGCTTCGCCAAGAAGATGCCGTACACGTA
CACGGGTGCTATCTGTATCGCCGTAAACCCGTACCAGTGGCTGGACCTGTATGGTCGCGAGCTGTACCTGCAGTATCTGGAGCAGCCGCGCGACTCACTT
GCCCCGCACCCGTTTGCCCTCTCGGCCACGGCCTATTTGGACATGAAGCGGACGCAGGTGGACCAGAGCATCCTCGTGAGCGGCGAGTCCGGCGCCGGCA
AGACGGAGACGGTCAAGATCATGATGAACCACCTGGCATCCATCTCTGGGGGTGGCAACCACGGCACCAAGGTCATTGAACAAGTGCTCAAGTCCAATCC
GCTGCTCGAGTCGTTTGGTAACGCCAAGACAAAGAGGAACGACAACTCGAGTCGGTTCGGAAAGTTCGCGCAGCTGCAATTCGACACCCTCGGGTCGCTC
GTCGGCTGTCTGTGCGAGACGTACTTGCTCGAGAAGAGCCGCGTCGTGGGCCAGACTGAGGGTGAACGCAACTATCACATTTTCTACCAAATCTTCTGTC
TCTCGGAGGAGCGCAAGTCCAAGCTCAAGCTGAGCGGCGACGTCACGAGCTACAAATACGTGACGGAGGGCGCGGACGCCGAGCTCACGGGTATCGACGA
CGTACAATGCCTCAAGGAGACACAAGAAGCCCTGGATATCATTGGCATTTCGAAGGAGGAGCAGAACGGCATCTTTGAAATTGTGGCGGCGATTCTGAAC
CTGGGTGAGGTGGAATTCGAGGCCAACGGCAACGACAACGAGAAGTCCCACGTGAGCAACGAGAGCATCGTGGACAACGTGGGTGCCCTGCTGGGCACTG
AAAGCGCGGCGCTGCACTCGACACTTCTGGAACGCTCGATCACGGCCGGTTCCGAGTCGTACACGATCCCGCTAAACGCCGAGCAGGCCTCAGACCTGCG
CGACGCTTTGGCGAAGGGCATGTACACGCAGCTGTTCGACTGGCTGGTACACCGCATCAACAAGGCTATTTGCTCCACGAACAATGTGAAGACGCACATT
GGCCTGCTGGATATCTTTGGGTTTGAGAGCTTTGACCAGAACGGCTTCGAGCAGCTCTGCATCAACTACGCTAACGAGAAGCTGCAGCAGAAGTTTAACA
GCGACGTGTTCAAGGATGTGCAGCAGGAGTACGTGGATGAAGGCATCCCTCTTACGCTCGTAACCTTCGAGGACAACCAGCCGATTCTGGACTTGATCGA
GGGACGAATGGGTATTGTCAGCATGCTGAACGAGGAAGTGCTGCGCCCCCAGGCCACGGATAGCACATTCGTGAGCAAGGTGCTGGACGCCTGCAGCAAT
CACCCCAGCATCGAGAAGAACAGAATTAACCCGCTGGAGTTCACTATCCACCACTACGCCGGCGACGTCACGTACAACGGCACGGGCTTTTTGGAGAAGA
ACAAGGACACTCTCCCCACTGACATGGTGCAGCTGCTATCTGGCAGCCAGAATGACGTCATCTCGGGCATCTTCACGCCCACGCAGAAGGGCAAGCGTAA
CAGCCGTGGCAAGCACGGAAAGGAAAGTCGCCAGAAGGGTTTCTTGGTTGGTAACACCATTGCTGGCGCCTTCCGCAAGCAGCTTTCGGAGCTAATGGAG
ACCATCAACAAGACTTCGTCGCAGTACGTGCGATGCATCAAGCCGAACGCAAACAAGAGCGCGGTGGAGTTCAACCGCCTCATGATTGTGGAGCAACTTC
GTTGTGCCGGTGTGATTGCCGCTATCCGAATCAGTCGTGCTGCCTTCCCTAACCGTTTGCCGCTCGTGGAGTTCCAACAGCGTTTCCAGATTATCTGCCC
GTCCGCG