Description :
From Genome Similarity Track
Location :
Scaffold_12:75753- 81644
Transcript NameFunction/comments
Phymu_g903hypothetical protein PHYSODRAFT_354854
Phymu_g904peptidyl-prolyl cis-trans isomerase, mitochondrial precursor
Phymu_g905eyes absent family protein
Phymu_g906hypothetical protein PHYSODRAFT_354853

Sequence
5891 bases(100 bases per row)
ATGAGCAGATCCGTGAGCTCCGCGAGGTCATTGAGCTGCCGCTTACCAACCCCGAGCTGTTCCTGCGTGTCGGTATCAAGCCCCCCAAGGGTGTGCTCCT
GTACGGCCCACCCGGTACGGGTaagacgctgctggctcgTGCTTTGGCGTGCAACATCAACGCTACGTTCttgaaggtggtggccagTGCTATCGTCGAC
AAATATATCGGTGAGAGTGCCCGTGTGATCCGCGAGATGTTCGGGTATGCCCGCGACCACCAGCCGTGCGTCATCTTCATGGATGAGATTGATGCCATCG
GCGGAAGTCGTTACTCGGAGGGTACGTCCGCTGATCGTGAAATCCAGCGTACgctcatggagctgctgaaccagcTTGATGGTTTCGACGCGCTCGGACA
AGTTAAGATGGTCATGGCTACGAACCGACCGGATATTCTGGACCCTGCTCTGTTGCGTCCTGGTCGTCTCGATCGTAAGATTGAGATCCCGCTTCCCAAT
GAAGCCTCGCGCATGGATATTCTCAAAATTCACTCGGGCCCCATCACCAAGAAGGGCGAGATCGACTATGAGTCAATCGTCAAGCTCACAGACGGCTTCA
ACGGCGCCGACATGCGCAACGTGTGTACCGAAGCAGGTATGTTCGCTATCCGAGCTGACCGTGAGTACGTTGTGGAGGAGGACTTCATGAAGGCAGCGCG
GAAATTGGCGGAAACCAAGAAGCTCGAATCCAAGATGGACTACAGCAAGGTTTAAATTCGCGGACAATGTTATCTGGCGTTGGGGTGCTATTTCTCCAGG
ACAGAATTGAGAAAATGACCACAGCGCGGTGGATCACTGTACCTTGATGTTTCTTGTGTCTCTCCTGCTTTCAGTTTGGATTTTGGACCTACTATTTTAT
CTGCGCCGCAAATAAACCGAATACGGGGGCTAACGGTAGTTTTGCATTTTACATCAGGTTGTTTCGAGATGGCGTCGGTAGGTGGGGCAGGCATGGAGTG
CTGTGAGCTGGTAGGTCTTATGGGCGATGTGGCATACCAACGCTGTAGAATGCTGCTTCAAGAATTGCGCAAGCTGCACCCAATCTTCGTGTCGCCTCTG
GAAGGGATGATGGAAGTCGAATACCTGGAATATTTGCAGAGCCTACAAGATAAAATCCCCAAGAGCAAGCGAGGAGAACTTCTGCGGACAACTCGGCCGa
tcattctgctgctgggttcCTCAACTGTCGtgctggatggagaagacgaatTGCTAGATTTCGCCATGGAGCAGACTCAGTTATCCAAGAACGAattgct
tgctgctgctgcatttggaGACGTTGTAGCTGACGGCGAAGGCACTGACAGCGCCAGGAGTGAAAAACTAGCACTGGCTGAGGAAACACTGGAGGCAAag
gcagaagaaggagcccAACAAGCTCTGGCACGCCATCGGGAGCTTTCAGGTCACCAATACGCTTTCTTGGTTTTTGAAGTTGATGGGGTAGCGCTGCCCA
GGGTCGAGCTGGAACTATTCCACAACGTGTGTCCTAAGACATGCAAAAatttcttggccttctgTGAACACAAAGTCCCTGATATTAGCGACGAAGCTCA
ACACTTGGGCTACAGAGGCAACACTGTGCACCGGGTTGTGCGTGGTGGCTGGATTCAAGCTGGTGATGTTGCAGGTGATGGACGTGGAGACGGATCTTGT
CGATCTCTTTACGGCCTTGAATTTCCCGACGAAAGCTTCGCCATTTCACACGACGCAGCCGGCATTCTTGTACGTACAAACTTTTTTATTTCTGTTCCCA
TCTCTTATCAGCATTTTGTTGCAGTCCATGGCAAACTCAGGGCCTCATACAAACGGCTCACAATTCTTCATCACTCTTGCGCCGCAACCATGGCTTGATC
GTCATAAAGGTAAGACAGACCGTGAACTCCACCCCAGCATACAACCTCACGAACCCTTTTTGATGCACGCCAGTTGCCTTTGGTCGAGTGGTGAGTGGGT
GGCGCACCATCATGACTATCGGAGGCCTTGAAACTCGTCAAGAGCGACCTTGTGTGCCCTGCACTATCGTCGATAGCGGAAGGCTCCAGTGATATACTGC
AAAACACTGCTAGAGGCACTTGATGAATAAATAAAGGCTTGGTATTTCACTGCGCATACGAGCAAGAACGATGAGCGCCTAGACTACAGCAGTTTGACCG
ACGGGTGACGAGGCTACAGACATTTGGGCCGCCACGACACTAGGAGAGTCAACTACCGCAGTAGTCGGAGtcgagttgttgctggctTGGACTAGCTGCA
GGTCATAGCGCAGTCGTTTGAGGTCCACAAGCGACCGGATCTTGTGGAACTCaaggccaagcgcaaggcttacctgctcttcctccaaCCCATCGCCAAT
GGCGATAAATTCCACGTCCGAAGCTTCATACTTCTCCACGATCGTCTCAAAGCACCGATACTTGTGCACTTTCGCCGAGGAGTAGACGCACTCAATTGGG
AAGAACGTATCCAACTGGTAGATGAGGCATTTGCACAACGCTGGCACGAGCTGCGTATTTGTGACCAGAATGTTAACGTTTTCCACCCTTACCTCCTCCG
TGTTACTGTCGCCGGTTGATTCAGGATTCGCTTCCGTTGCCCGGTTGTGTGCAGACCTTGCAATGAGCCCCAGCACTTGCCGAGCTTCGTGCAGCCAGCC
CGTCGAAAAGTTGTCAATAGCTGCGATGAGTGCGCAGCGGATGGCAAACCACTCGCTGTTTGCATCATGCAGGAAATCCACGCGGCCGCGACGTTCATAG
ATTTCACGGATGCGATCATATCTCTCTTGCATCGTTggctgttgtcgttgttggtgttgaTCAGGCCTCGACGTACCAGCAGCTACATGGGCGATATGGT
CGACGTCGGTATCATGCAGAtcactgaagaagaaatgtttctccagcatcgccaacAGGAACGTCATCATCTGCTCGCCAAGAGCCACTCCAGGTGCCAC
CTCTTTGCCGTGAGACTGAGCGAACGTGCCCGTATACAGGGACGCGAACAGCACCAACGTCTCGTCCAAGTCCCAAATGAACACACGTCTTCGAATACGC
GGCTTCACGGGACTTTTAGCTTTAGATACCTCCTCTTGCGTCTCCTCgtttccttcctcttcatcaccagcTTGTCTCTGCCCGTCAAAATCGTCGCTCT
GGTATTCATTCTGCCTGGAATCGTCAGCTGAGTCTCTTCCCCCTGGATTAGACCTCTGTCGCTTCAAGGGGCGTGACGCGTAGCTctcgtcaccttctcc
gTCCACGTCTCCGTCACGTGCGTCTCTCTTCTCTCCATTATTGAGCAGTTTAGTGATGCCTTTATCCACTTCATCCGGTGGCATGCGGTGCGGCGTCACA
GCCGCTTCGAGTCTCTTGGCCGGCAGGAAGGACAGGAACAGCGCCAACAGCGTAGCCCACAGCCGTGCACGCCACTTGAGCGcctggcgctggcgctgca
gtgccTCCATCCACTGCAGCCCAAGTAGAAGCGTGACCACCCCGCACAGACTCACACCCACAAcgggcagcagcaccaacttgGCCATAGCATCCCCAAG
TCGCGCGCGTAGTGCTGCCATCGtaacctgctgcagcgtcttgtccCTCTTCGCGAGTATCTGCGAGTGAGCCGCGTCGCATAGCGGTGGCTGTGTCCTG
CGTGCCAGCATGCCGCGTCGAGGAGCGATCTCGCCGGTATTTCGAATGGAGTTCTGTTCTGACACAGGCGTCGTCGATGAGACTGTCCAATGGCAGAGCT
GGACTACCACCACCGAGGCTTTTCTTAGCATAAACAAAGACTGGATGATATTGAAGCGGTAGGTGGCGACAAGTGTATAGATGGTGGTCCGTGTGATGTA
ATGGTTGTTGCCTTTTGCAGGTCATTTTTGCACGGGTCCTTGTTGCGATCTGCTTGCAGTGCTCAGCTCACATGCACGTGTATTGCGTCGCGTTCCGATA
TCGATTTGTACCTTTACCACTATGCGTCATGAATCTAACagcaagcaagcagcagaagcgttAAAAGTTGTGTGTTTAAGCTAATAGGATACCGCATAGC
GGTCGCGGGCTCAAGGCGCAAAATTGTTGGCAACCACACTGTGGCACCAGCGCAATTGCCTCACTTCAGCCCGAAAATGTTGAAGATGCGTCAACGCTAA
ATCGAATGGCAGATAATGCACGTACCGCGGAGGCAAGATCGCGCCATTGCTGGAGTACCAACGGTAACTGCTGTGTCTCGCTCGTCGTGTGATTTGGCAC
GTCCctggcaacagcagcaaaccgATGTTATGTTTCCAATCCTCATCACTGACACCACGAGCTTGCAGCTTACCACCACGTAAGCTCCTCAAAATGATCT
TCCACCTCCCAGACGCGGCCCTCGTCATCCGGGTGTCTCAAGCCACTATCCTCCAACACGAGGCCTAGAACTCCCACACAACCGTCAGCGATTCCTTTGC
GGATGAATGCACACGTACGTCTTTGCAACGCACCGCTGTATCCTAAAGACCCCAACGACAGCTTTTCACCCTGCAGCTGGATACCACGGAACTCCGCACA
CAACTTGCCATTTCCGCTATTCTGCTTTGCCTCCATCATGACGTCCTGCTCCTCCGCGCTCTGCCCGCCATGGTCAgtgctgttgctgttacCGTCGCCA
TTCTCAGGCCGGAAGAAGGTCTTGACAGGCGCCGAGCCATCAAAGTGGATACGGCACGGTAGTGAATGCACGCTCTCCTCCGCTGGCGGTAGCGGACAGC
GCGTCAGACATACACGCACAATGCTCGAGCCGTCGTCAGCCATGCTCGCCTAAACTTATACTACAGTAGTTCTTTAAAAAGGGAGTGAGATTTTAGCGGG
AAAACGTTCCCGCCAAAAaacatttttattttattttactGGTTTTGTCATTATTTGCCAATCCAAATGGCAGCGGTAGGTCGATGCTCAATGGTGATCT
ACGTTGTCTCTGGGCGACATTAATGTATCGAGTACTGTGTACAGCAAGCGATAGCACCTGTGAGGCGCTCGCGCGATGAAGCCAGCAAACTACTGGGcga
gaaaatgctgcagggGTGGACTATGCTGGGAGCTAGCTGCCCCGTTGAGGATTGCTACACGCCACTGATGCGTAACAAGCAGGGGAAGGTAAGAAAATAG
CGTCGTGGTATCCATAGCGGAGGTATATTTACCAGTTCATGTGCTTTGTGTGGCCGTAGATGTTCTGCGTGAGATGCGATCAGTTTGTGGTCTCGGAGGT
GGAGGCTAAAAAGCAACAGGAAGAACAGGAGGCCGAGGAATTGGCTGTGGCGGAGAAAGAAGCAatggaggctgaagctcaGGCTCAGGCTGAGGCAGAG
CGCAGACGCCGTATTgagcagcagttccgctTCGAAGAGCAAGCGAAACAGGCCAGAAAAATGCAGGAGCTTGAGCAGGCGAAgggaggaagagcgacgg
cagcacctGGATCTGGTACTGAGCGTCAATTTCTGACGTTGGGTGATTTATTGCTGACTAACAATTGTTACTTGTTGCATGCTACTGTACTTCTTTCGTG
CAGCAAAACGCAAGATCGATAATACCATGGACAGTGCCGGCTTGGACAGTGATGCAGAAGTGAATGCCATTCGTCGCCAAACGCTCGCTGCTCTTTATCA
GGTGGAGCATCCTCATTTCTTTTTGTAAGGAGCTGGTCCTGCCGTGTGTTGCTTCTGGGAGTGTTGAATGTTGATACACGACGCGAGATTGCTTTGAGAC
GCGAACCAGGAGACACAAGTCCGAGCTTTGCATGTCCGCAAGCCAACAAACCCAGCTTACCACGGCGGACCACCCTCTGTTCAAAATCCTG