Description :
From Genome Similarity Track
Location :
Scaffold_74:75744- 101095
Transcript NameFunction/comments
Phyci_94728protein phosphatase PP2A regulatory subunit B putat
Phyci_281052conserved hypothetical protein
Phyci_94730cell division cycle 5-related protein, putative
Phyci_315603conserved hypothetical protein
Phyci_232948Hypothetical protein
Phyci_232905Hypothetical protein
Phyci_587007Hypothetical protein
Phyci_526515protoporphyrinogen oxidase, putative
Phyci_30030protoporphyrinogen oxidase, putative
Phyci_281065Hypothetical protein
Phyci_232861conserved hypothetical protein
Phyci_232953conserved hypothetical protein
Phyci_68174Hypothetical protein

Sequence
25351 bases(100 bases per row)
GCAATGATAAACTAAATGTAAAAGAACCAACTTCTTTGATATACTTGTTCGTGATATTTCCCTTGATACGCTTACACAAACCTCGATCAGCTCCAGTAAC
AAATAATGTGTGCGTGTGGTTTCAATCGAGGCTGCGCTTCAGGAGTTTGTTCGCTGGTGTGAGTCCCACTACCAGGTTGTGCTCTCTTACCGCCGGAGAT
TTCACTGCTACTTTTCTTTTAGCGACGCCACGCTCGAATTGCTTAGGAGGCATATACGAAAAGGCTGTTGCGGATGGAGACAGCCACTTCGTTCAGTGAC
GGATGCCAGCTAGTCTGCAAGATTTTCTTCGAGAAATCCAATGCGTCGGGATCGCCCGGAGCGGGCATCGCAGCAATCTGCTGTGCGAGACCTCGCTGCG
GCATGGAGTGGCGACGGCTCACACGTGCGGTGCGCGGTGTGATCGAAATATCGGCGCGCCCATAGCGGTCATAAATATGGAACTCGCTGTTGTACGAGCC
CGTGATGAAGTTGTTGCCGTCTCCGCTAACTGCGCACTCAAATTTATCGAAGATACAGTCGCTTTCGTACAGGTCTCCCAACCGAGGACGAAGATGCTCG
TGAATCTAATGGCAAAAACAGTTGCGGCATGATAAGTGGCATTCTTGAGACAAAGCAGAGTAAAGCACTCAATAAACACCTCGACACAACTTACATTGAT
TGTTTGGACTGGACGTGAGTTCATGTTAATGTCCCAGACTTTCAAGGTCAGGAAGTCGCGCGCAATGATATAGCGGCCGTCTGGAGAAAACTTGATGTCC
GAGATGGACGCGATGATCTCGGAGAAGAAGCTTCGCGCCTCAGGGTCTTCCTGTTCTTCAAAGACTGTTTTCCATTGAAGTAAGTAGTTATAGTTAATAG
TCAATATTCAGTAAGAGAGTAAATCATCGAAACCAACCCTGGGAGTAGGAGTCGCACAACGCTGCCTGCCGCATGTCCCCAAGCTTGATGGACCCACGAC
TTGTGCTGTACATCATCGTGTTGCAGTGTGTAGGATGAAAGTCTGCAGCCGTGATAACCTCCGTGAGCTCCTCCATGTTCGCTGGCTTGATGTCCACGAT
GTCTACACATTAGTGCATTTGTCGCAACATTGAGTTAGCAGCTGCAATCGCATTTGACAGGTGACATCAACATGTGCACGTACTAAAGCTTTGGTCGGAG
TTACCCAAGCTCCACAGGTTCACGCGAAGGTCGTCCGCCGACATGAAAGTTTCTCCGTCGCTATTGATTGCGATCGAGTTGATGTGATACGTGTGCGCAT
TTGCATAGATGCGTTTCGCGGTGGACGTCGTCACGTGGCCGCGGACATGCGTGTGCGGTAGACGAATGAGTGCCGGCGTGATATTCGCCCGCGGTACGTG
CGCGAGGCCTTGCTCGTTGAACGTGGTGACCTCACGCACACTGCGCTCGTGGACCTTCCACAACTTAATGGTCTTGTCGTTGGTCGATAACAAGCACTGG
GACCCGTTGGATGGTCGACACCACTTGATCTGGTTGATTTTCTCTTCGATCTCGAGACTCTTGAGGTAGTCGAACTCGGCGTTGTGGCTCTGGAACTCGG
TGTAGAGCTGGTACTGCGGGTCGTTGGAGCCGCTGAACATGCTTTGGTTCTGATTAACGAGGGTATAGTTAGGGAAACTGTCACCCACCATTAAGAAAAA
ACTGTAAGGCGCCAAGAGAACTGACCGATGCTGGATTCCCGTGGCGGCAGTAGATGGAGACGCGTCCGCCCTTGTTGCCTGTGGCGAGGAAGTCTCCCGA
GCGGTCGTACTCGATGGCGGAGATCACCTCGGCTGCATCACATCACCCACGATGAGAGAACTACACCTCAGTACCCTGTTGTCTCCGTCCTCCTCCTTCG
TCTCTTTCTTACCTTCCACGAAGCTGCGGGCGCTCTCGCCGGCCGAGAAGACCTGGCCCCACTCGGCCTCGGCCTCGCTCGTGGGCTCCGCCATGTTGAC
CTCGAGCCCGGCGGCGGCGTTGGTGTGCTTGATTCTGGAGAGCGCTCCCACGCGGGCCTCTTCTCCCGCGGCGGCGACGTCCGTGGCCTGCGTCATGCAG
AAGGATCAGGAAGAGCTCTCGTGCGGCGCTGCGGATCCTGCGCTGCTTCGCTTCTCGGAGGATCTCGCGCTCTCCTGGCGGTGGTTTCGCGCTGTGGCCG
AGGGGGGTTTCGCCTCTCGGGTGTCTGCAGACGGGCAGGCGCGACCACTTAGGAATGGACGGCGGCCCGGGCGGGGATTGAGGCGACGGCGTTTCAAGGC
GAGAGGCAAATCCGCGCGGCACGGGCTGGCTGAAGCGCGCGGACGCTGACGGGCAGAGACTGCGCTGCGGCGGCGCCGGCGAGACGAGATCGCAATGGCG
ggcggcggcggcggcggcgacggcgATGACCCGGACTGCGCCTCGGACCAGACGATCGCGATCTTCAATCGCGCTTTTGTTCCGCGAATGGCAGAGCGCA
ATTTCTGCCAATCAGCGGCGCTAACGCAAAAATCGAAGCAGACCGGGGCCATAAACGGGCGCGCGGTCACGGCCCGCAATCCGCCAGTGCGACTACGCCG
CTGCCACTGGCAGGCCGCAATGCAGCCGACGCGGGCGAGTGGCTGGAGCAGTCCTCGCCCTAGGGATGGCGCTCGCTCGGGACGACCGAGATATGCGTTT
CGCGGAGTAGGAATGAGGCTGGCGACCTGCTGGCTGTCGCCGCGTGCAGCAACGAGGCCGCTTGTTGCGGCTCTCAACGACGACGACGAGCACCGCGGCC
CAGGATCGCCGTGTTGGGCTTTGCCTACGTTCGCGCCGTCCGGTCGACCTCGGCGGCAAGATGCCCGCGCGCCCTGACAAGCTGGAGCGAAAGCGCGGAG
CTCCCGGGCTCCTTTGCTATTTCCTGCAGTGCCGTTTGTCATGCAGGAACATGCGAAGTCGGCGACAGCAGCCTAGGTAGGTACTGTATCGCGCGAGAGC
CCTCGGCCCAGAGTCCTGGGCCAGAGAGCGCTGGAGAGCACTCTCTGCCAGCGAGTCTCTGGACTGGACGCGAGGGCGTGCTTGGTCAATGCGCACTGTT
TCTGGTGGCGCCGAACAGCAGCAAAGCTTGGACCGCGCAGGAAGCTGCTGGACAGAACTCAAATCCAAATGACGCTCTCCTCAAACGATCCAGGGCGGTC
GTGCCGCGGGCGGCGGCTGCCTGATGACCATGACTCGGTTGATTGCTGCTGTCGGCACTGCCGACTCGGTGCCCGCAGGTAAGGAAGGACCCATCTGGAT
CCTTTCGGAGCCACTTCAACGTCAGTTACATAAATGTCCTCCAGAGGTGGCAATCCGATGTAATCCAATCCGATTGGTCGAAAACTGTGCTTCCAATTTG
GACCAATCCGAGAGAACTATGGGTCTGGTTACGCCGACACAACTCGACCTTGCCCGCGGGAATGGCTCGAACAGCTCCGTCGCGCTCGCGCGCCGCCAAG
GCGCCCGCCGCCTCGTCCGCGGCCAGCAAGCGGCGCCGCACGACGTCGGAGTCCTCTTCGTCCGAGGAGGAGCAGGAGCTGGTGAGCGACTCGCGACGCG
CGCGCGGCAAGCGGCAGAAGGCCAGCGCCATCCTGGCCGAGTTCTCGAGCCTGGACGCGCTGCTGAGCAACGACCTGGCGGAGAAGCGCAAGCGCCAGAA
CCGCGAGCGCAAGCTGCAGAAGCTGCGCGAGGAGAGCGAGGCGGCGGCCAGGGACTCGGCGGAGGGCGGCTCCTCGTCCATGGGGAAGCTCATGAGCCAC
ATGGCCAGCAACATGTCGGCGCTCTCGGGCGACAGCTACCTCTTCTCCGGCTCGGAGGTGACGGTGGCCGAGGAGAAGTTCGGCTACGTGTTCACGCCCA
TCACAGAGGTGCATCGCGAAGCTGCTGCTGCAGGGGGGAGGGGAGGGGAAGAACTAACGACCGCTGTGATGTTTCTGTTGCTGCAGCCGCTGCCATACCG
CACGTACAAGGCGACAGAGACTGAGTTGCAGGGAGACCTGAAGCTGGTGTACGAGACCATGCAGTCCACAGACGACGCGGAGCTCAGCGGACTGCTGTGG
TCCAAGGCAATTTTGATTCGCTGCATGCTCAAGCGCCAGGCGGAGTCGACCACCAGAGGCTCAGCCACGACCCCGATTCTGCTGCCGCCCAAGATCGGCT
CGTGGTTATTTATGACAAGTACGTGGCTGTGGAGGAGTGGGTACTTGAGAAGGGACATCATCTAACCAGGGATTCTTCGTGTTTCGTTTGGATTCGTAGT
GTCAACGCACAGCAATAGTCACGTGGTGGGTGGCTGTTTCAGCAACCTCTTTCTCGCCATGAGCTCGGCCAAAAAGGCATTCGTTCCTAGTTTAAGCTCG
GCTCTACCCGTCGCATGTTTTGTACACCCGATTGAAGACTTCCGCTCGACGTTTGGCGATGACATTCCGTCAATTGAAATGGAGTGGAAGCCGTCCATCT
ATGACTTCCTGAATGCCTTCCGTGCCTATGGTTTCCAGGACAGCAAAAGGTCTATGAGTGTGAAGAGCAAGATCCCGGTTACTCCGCCGTCGACAAAGAA
AGCTCAAGCGCTACCGTTTCCGACCCTCAACATGCACTACGTGCTGATGTACTTGGTGTTGTGTTTGCGCACGAAGACGTTGAAGCTTGAGGGTTACGAT
GCATTTAGCTTCACCATGTTCTTTCTTCGGATGCAGTTTGAGAACGATATCCACGCCAGCATCGTTGATCTGGCCACTATTTGCATTGAAGAACTCCTGG
ATGTGTTCCCGCGTGCTGAGTGGCGGAGAGAGTGGGCACCGCAGCTTGTCCTGCGCATTGCGGGGGCCAACGAGGGCTTGTTTGACTCAGCTGCTGGGTG
GTTGGCCGTCGCACGTCGACTTCCGCGCACGATGCGAGGCACGCAGCTCACAACTGGATTATCGATCTACGTTTTGCAACACCGCATCGACAAAAATGCA
GCAGAAGGGGTGCGTCAAGCTGTCATTGCTAAATTCTCTCTGTTTAGTTTGCTAATGACTGGCTTGTGTGTAAAACGTGTAGACAAGTTCTGAGAGGCCT
CTGAAATTTCCGATTCAGAGTGGGCTAGTCGTGGACATCGTCGCTGGCATTGTGGAGGACCTGACTCACAAATATGCCGAAACTCGTAAAAACGGCAAGG
CGTCAAAGACCACGCCGCCGTTCGATGTGCTGTGCAAGAAGGTGGCATTGATGGATCTAGCACTTCAGGCATTCCTCAATATCCTTACGCCCAAGGAGAT
GAAAATCATGTTGGGCAAGCTGGACCAACTAGCAGACACACACAAGTCCACGATGTCAGCAAAGTGGCACGAGCTCAAGACACTCGTTAGCCTCATGCAC
CGCAAGTACTCGCTCGAAAACTTGCGAATCGGTCGAAGTGCATCTCCGTCTGCAAAAACCGTTCTGTTCCGTGACGACGACGATAGTTAGGCAGGCAGGC
AGGCGAGGTGACTTCTTCACAGGAGAAATAGACTAATTGAGGGAGATTTTAATTGACGTGCAGTTGGAAAGGTTTTAGTATTAGCAGGCAGAACGATCTG
CCACAACTGAGCAGCACGTCCTGAAGCTACTGCTGCTCTTGGACCAATGCTGCATATTGCTTCTGCAAATTCACCTCGATCAGCTGCTGCGAGTTAACCT
CGTTTGCCAACCGGGCCATGCGGCTCTGCAGAGCCTGGGACTCAAGGCTCGACAAGTTCTCGAAGCATGACTGCTCAATTGTCGCGTTCTGAAGCTCGGT
CATGTGGTCACGCAGCAACTCAAGGCCCTTTTCTGAGCGACGGTGAAACCCGCCATTCACAACCCGCGCTCGCTCGTCGAGCTTCTGTGCGCGCTTAGCC
AGGAGCTGCTCAGTTTCCTTCAGCTCTGCAAAGCGAGCTTGTACGGCACGCAGCTTGTCCTCATCAGATGCTGCGAACTGGAGATGCACACCGTCGCTCT
TTCCTTCGCCGTCAGCTTTGCATAGATAGCGCGCTTGAACCTCCTTCCACTTCGTACTGATAATTTCGACGTCTTGGGATTTCCACACATCGTCTTCACC
ACTCAGGCTGGCCTCGATCTGTACCATTTGCCGGGCGCGTTCCATATCACTGTCTGAGAACTGTTGGAGATTCGGAGCTGCAACTGAGCTCGAGGATTTC
TTGCGCTTCTTGCTTTTCTTCTTGGCATCGTCCACCGGGTATTTAACGATATCATACTCCAGCATTCGGTACATTTCGTCAGCAACCTCCTTCAACGCGC
TGCGAATTAGCACCTTTTTCACCTTCGAAGGCCGAGGAAGGTCCTTCTGTACAGCCGTCGACCGTCGCTTCAGCTCCCGCTCTCGTTCCAACTCGCGCTG
ATGCTTTTCGCGGACTTCGCGCTCTCCAGCATCCTCCTCCTTCAGAGCAGCGGTACGCTCATCATCAGCCTCCTCTTTCTCCGGAATGTTAATTTCGTAT
TCATTTTGCGGGGCCGGCAAGCTGTCAAAACCTTGACGCAGGCTAGCAGCCAGTCGCTTGACTCTTGCCTTTTCAACTTTGGCGCTTTCAGCCTCCGTGC
CGTAGAGCTGTCCTGGGTTAATGCCCAGCTCGTCACGCAATGGCGTCCGCGCAGCTGACATCGGTGTTTTGTCATCAGCAGCCCCGGCCACCGCCGACGA
AGGTGTCCGAGATGGAGTCGCGCCCGCATAACCCGTTCCTTCATAGAGTTCAACGTTTTCTCCTCCCAGCAATGGGGTAGCGCTGTTCCTCATGGCGAGC
AGGTTAGCCGTTTCCTGCATGATATTGTCGTGCACGTCGCGACTAGAAGGCGTAGCTGTCGCGCCTCCATTAGCAGAGCGAAGCGGGGTAGCACTGTAGT
CACCCATGAGTGCACGCGTCTCGGTGGCCGAGCCATTCTCAAGAGCAAGAGCAGCTGCGTGGGTGGCGTGCATGCCCAGTTTGGCCAGGTCACTCAGCTC
CTCGTTCGAGACCACAGGCGCAGGCAGCTCGAGCGGGGTGCGCTTGATCGCGTTGATGGGGTCGTTCTTCTCGTTCACCGCTGCAATCACCTGCGGCAAG
TTGGTCTTCATGAGGGACTTCTGCCGCTTGGCGTCCTGCTTGCGCTCCTTCTTCTCCTGCGCGTCGCGGCGCACGCCCTCGAGCTTGTCCAGCTGGAGCG
CCGCCTTCTTCGGGTCGAGTCCCTTGCTCGACAGACGTTTCTCCTCGGACACGTCGTAGAAGCCCGCGGGCGCCTTCTTCTCGAACGGGATCTCGCTCGC
GTAGTCGATGAACTTGCGCTTCTTCATGTTGACCCGCGGGTTGGAGGACATGATGCCGGCCGCCTTGAGCTCGCGCTTCTTCTGCAGTGCGGCGAGGCGA
CGTGCCTCCTCCAGCTGCTTCTCGCGCGCCTTGCGCTTGGCCTTCTTGCCCTTGGTGTTGGCCAGGCGCGCGCGCGCCTCGGACAGCATCTCCTTCTCGT
CTTCGTCCATGTCCACGGGGTCGGGCCGCGCGGGCTTGTTCTCCGGGTTGGGGTCGATCTCGCCGGGGCGCAGGCGGCGCGGGTCATCGCCCACCTCGAC
CCCCTCCTTCTGCTGCGCCGCGTCCAGCAGCCGCTCGTAGTGCTCCATGCACTGCGCCGCCGTGCGCCCTACGATGGGCGCGATGGTGCGCCACTGCGAG
GGCATGAGCTTGGCCAGGTGCAGCAGCTTCTCCTCCTCCTCGCGGCTCCACTCCGTCTTCTTGATGCTCGGGTCCAGCCACTCGTACCAGCGCGCCTTGC
ACTGCTTGGCCGACTTGCGCGACAGCAGCGACGCCACGCGCGCCCACTGGTTCATGCCGTACTTCATCACGGCCGCCTTGAGGATCTCGTCCTCCGTGTT
CTTCCACACGCCGCCCTTGATCATGATGCGCATGGCTGCTGCGGGGGGGGAGGGACGGAGGCGCGCGCGCCTACAGAGCTACAGCGGACGAAGAGCTAAT
GGCAATGGTGTCGGAGGCCGCGCCACACCGGGTGTACACAAATTTTGGGGTTGGTGTGCAGTTGGTGTGGCACGGATCTTGAAGTTGGGCCTGGAGGACG
ACTGTGCAAGTAGCGATGGAGCCGCGCGGGCGCAGTCTGCAGGCGCAGCTGCAGTTCATGGAGCGCAACGGACGGGCGCTGGAGGAGCTGGTGGCGCGGA
TGCTGAAGGCGCGCGAGGAGCAGGAGGCCTTCCTGGGCGCCTTCGCCAAGAGCCTCGAGGACATCGCGGCGCAGGAGGAGTGCGCGCCCCTGGCCCAGTG
TCTGGGCAGTCTGGGCGAGTGCGGCCAGCGGCTGGCGAGCGAGAGCCACGACGTGATGCTGCTGCGCCCCGAGACGGAGATCCTGCAGGTGGTCACGCAG
ATCCAGGACTGGGCCGTCGTGCCCATGAAGGTGCGCGGCGGCAGGAGGCCAGAGGAGGCGGTGCAGATCTGACGGTGCTGCTGCGGTGCAGAGGCTGCTG
GAGGACCGGGAGAAGGCCATCAAGATCGAGGCCAAGCTGCAGAAGGAGTACGACGAGCTGAGGGTGAGTGGGTGTGGGTGGAATGTGCTGCAGTTGTGGT
GCTGAGTGTGCGGCTGTTGTGGCTGCAGCGAGGGAGCTCGGCCAAGGAGAAGGAGAAGAAGCTGCGCATGCTGTCGGACCAGAAGCGGCGGGTGGAGAAC
GTGAACGCGCTGCTGGAGACGCACCTGGAGAACTTTGATCGCTACCGGATCCAGAAGATGAAGGTGAGTTTGTTGCCTTTGCCCCATGGGCACTGCGCTG
CACCCCAAACTGATGAGCAGTACTGTGTATCGATGCCAGAAAATCGTAAACGAGTTGGCTCGCTCCCATGCCTTCTACCACGCCAAAGGACTGGAGCTGT
TTGCTGCTCCGTGCCAAGCCATTGCGAAGCTTCAACCCACCGACCATTTGAAGGCGCCAACGCAGGCTAATCCAGCTGACGCGAGCTAGATATCAACCAA
CTGCATCATTCAGCGCGGTAGAGCCGTAAGTATTTTTCATTTCTTGAAATTATCTCGCCGTCAGTCGAATTTCCCTGTACAACGCGCTGGAGCTATAAAG
CCGCCGAGGAGCGCCCTCTTTGCCGTTCCTTTCTGCGCCTACTGTGACCAAGTTTTGCCATGCTTTCCTGTAACTTCCGCCAAAACGAACCCCTTTCGCT
TGGCGTACGCTGCGGGCTATCGGTACCAATTCCAAATTGCTGACGCCGCGAAATTCCAGGTGACGCTGTCCAGCTCTGTGGTGAATAGCAATAATCTTCC
AGCAGTTTGTCACTGTAATAGCACCGTTTCTGCAATAACAACTTAGTTCTAGGCTTAGAAAATCAAAGTCAGCCAGCTTGTGAGCTTGCACGTACCTCTT
CGAACTTCTCGTAAACCAAGTGCACCGGCAAATTCAAGTAGTTAGCCAGGCCTAGCTGAAGACTGTTGAAATACAAAACCGATTGCACAGTATAGTGCGT
AAGAAAGCGTGACAATGCGCTACACTTGTAACATTGCAAATGCGGTACCTCATTTGCACCGGCTGCAGAGATATTTCTCGTCGAGAAAACGTTGGAGTCG
CTTGTGACACGAATGATACGCCGTAGTCGGACTGCGCGCAGAGGAGAGATCCATTAAGTACTCACTTATCAAAGTGGTTGCTTCGATCAAGCGTACCTGG
GGCAGGTGCGAAAACTTCACCGCGTGTTCGTACATATGCCGATAGACTGCATCACCTAGCGATTCCAGCTCACTGCCACGCTCTTCGCAAAGTTGAATCC
TATCTATGAACGATGACCACTACAGTACCACATGAATCGAGAAACGCCGTCAGAATGATCTACGATAGTTTTACATAATATGAAAACGAAAGCCTTACCT
CATCAAGCGTTTCTTCGGCAGTGTACTTCTGAATAAAAGGGTGCTGAAGCAAAGCCTCTGCCGATGATCTTTCTTCGGGATCAATTAGAAGGCACTGCAA
GTGTGACAATTGTCGGTTTACACGATCTTGTTGAAGTTACGATAGCAAAATTGGTCGTACCTGATCAACGAATGAGCGACATTCCTCAGAAAAGGACTCA
GCTGGCAGCTTTAGGCACTGTTCGTTTGCAACCTGTACCAACACAATCCACTGTTAGCACGCAGCCTTCATATTCATTAGTAATTGGCCCGGCCCAAACT
TACAGAATCAACCAAACCGAAAAACCCGTCTTGCGTAGGAAGTGGATACCGACCCAACGCGACGGATATCAGCGCTAGTCCAAAGGACCAAACATCGGCT
ACAAAAGCGATCAGTTAGATTCCTCAAGGGCGTCGCAGATAAACAATGTAAGGCGTACCTGGATAAGAGTAATCGCCGCCGCCTATCCGTTCGGGGGCCA
TATAAAGAAGTGTCCCCACAAACGTTTTTGTTGTGGTAGAGTTGTCGTTCAGTGTACGTGCCAAACCAAAATCCGAAATCTTTACCTCGCCCTGTCGATT
CGTCAGCAAGTTGTGTGGCTTGATATCACGATGCACCATTCGCTTATTGTGAATGTGTGCTAAGCCATGCAATACGCCGGTTGCTAGCCGCGCTAAAACC
TTCTCATTTTGACAACCGCCGCGTAAAACGATATCTTGCAATGACCCCGTGCTCATATACTCCATCACCATGCAAATTGAGTTTTTGGGGCGGTCGACAA
AGGCATCATAGAATGAGACGATATAGGGACTGGGCCTGCATTTAAAATAATCAGATTTGCCCAATGTTCAGTCAAAAAAGTGATCTGGGGTGAAGCATTA
ACCAATCGAGCAGCTTCCAAACGTACTTTGCTTTCGGTTTGCTGGTGCTTTTAACGGGGGCAGGATATTGAGGCACTGGACTATCGTTATCTGCCATCGG
TACAAGGTTTGAATACAGCGCATGTAGCTCTCGAACCATTTGCCGACGTTGACCTCGCCCATAGACCGGTACGTCCTGCGTGACGTAAACAATAAAAAGA
AATTGGAAATGTGAGCAAAACCGGTAACAGACCACGGAAGAGTATATAAACTAACCTTCACAGCGACCACTTTCAGTGTAGGGATGTGGATAGCCTTATA
CACCACACCTGAAGCTCCTCGACCGATTTCTTTAACACGCTCGAGATTTTCTTGCAAATGCAGACATGCTGCATCTGGGGACGAAATACCAGCCTCTGAT
ACGGCTACGTTCTTCGTAGTAAACATGCCGTGGTTTGGAGAATAAGCGCTGCCTGCACTATGCCTTCCCCCTTCTATAAAAGTGAATTCAAAGAGGTAGA
TACAACAAGCAGGTTAGCACTTCACCCAATCACAAACCCCAACACATTTGCGCCGCGCACCGCTAGGGGATTGAAGATCCGACTCGGAACCGGAGCTGAA
ATTTAGTTTCATCAGTGCCTGCTGTGCAGCACTTGGGCCATTGGCAGGTGTATTGGATCCAGACGCGGCCGCTGCTGCGATCGCAGCTGCCTCCATTGCA
TCCCGCTTAGCAATAAGCCGGGTGGCAGCTCGCTGAGCACGCTCCTCGGCCTGCTGAGGTGTAGGCATATCTTCCAGCTTTAGTCGCAACTGTGGACGTT
TGCCTGGACGGCTACCTGGAGTCCTTCTCGCTGACTCGACAGTTTTCCATTGCGGTGTAGCACCACCTTGCGGAGTGAATACCGGCGGCGGAGTTCCTGC
TGCACCCGACGACTCGGTATTTTTCGCTGGAGATATCGGCCGCTGTCTTTTCTCCTCCAGCGATAGCTGGTTGGTTAACGAGTCGATCTCGTTCTCCAAT
TCTCTGGCCGAATGGTCCCCTTTTCCCACCGTATCATCCGCAGTCGTCCGGCGAAGCCCATTGCTATTCGCCACAACTGGTGCTGGAGGGGGCGGAACAT
CACCACGTGCACGAGAAGAAGGCGACGGTATCGCCGTCGTTCCCGCCTTGGGTCCACGCGCCGCTTGTGACAGCAGCTCCCCCGTCCGCGGCTGGCTGAG
CAACGTCACCTGTGCCGTCGTCTCCGACTTTGTATCCGCCGGAAACACCTTGTGCATCCACGGACAGTCCCACGACTTGACCTCTGCAATGCGCAGCTCG
CGCGGACAGATGTCCGGGAAGATCCGAGCGATCACCTCGTCGTCCGCCTACGGCGGCAACACACAAGACACACACAGTAGATCAGTCTCCAGCCTCCTGC
GCCAACTTGTCCCTGCAGGCTGCTGCCGCACCTGCTCCGTGAGGTTGGGCGCCGACTGAGGCCTGGCCAGCGCGCTCTTGTGCACGAGGAACGTCGCGTG
GTGCGGCGCGCGCCCCGCCCGCAGCAGGATGGGCGCTCCGCCGTCCGCCGTGTTGGCGAAGGACGAGCTGTTGGACTGCAGCGTCGTGTTGGCGGCCGCC
CGCGAGCGTCCCTCCAGGCCCGCGCGCGAGTGCTGCTCGTAGTTGGCGCTCTCCACGCGGCCGCGCTTGCGGAACCTCTCCATGAGCGTCTTGCGCGAGA
CCTCCTGGATGGAGCCGTCCAGCAGGTCCCGCCGGTGGCTCGTGGACCCGGAGGCGGCGGCGCCCACGGCGGGAGACGCGGGCGGAGACGTCTGCCGGGC
CGCCGCGGGCTTGGACACGTGCCGGGTCTTCTTCTTCTTCGAGCTGAGCTGCTCCGGCATCGCGTCTGCCTTGCCTTGCCTTACCTGCCTACACCTGCTG
CGACTGAAGCTCGAAGTGTATCCCTCCTCGCAGGTCTACCTCCAGACACAGATCAATGGATTTGAGAGGGAAATCTACGACAGTTGAAGAGCATGTGCTA
CAGAATCGTATTAACTGTTATGGAGCAACTTCAACTTGCTCACTGGCACCTGATAGTGGGGCGAGTTTCAAACTGTGGTTTCACAGGCACAGTAGTGGAC
AGCACAGCCAGCAATCCCAAGAAGAGGAGCGCATTGACTACATGGTTCTCAACAAGATACAAATCTTGTACCTTCGCGTTTGGTTGGGTCGCTAGTGCTC
TCTCTTAGCAGTACCATGTTTGCTGGAGGCGCGGCTAAGCCTCAGGTTCTGATAAGGATCTAAATACGCCTCGACGAGCAAGTTGAACGTGCCAAATCGC
CTAGCTGCCCATTCATCTGCGATGCTGCAAGCCCTGCACTATATTTACGGGATGCTTGACCTTGCACGCGGTCGATAATAGATGGAAACCTCTTGGTCTA
TCTCCGTGCGCTCGTCTTGCTTGGCGTCTTGTCTGGACGATGACCCGTGGTTGGTTTCTGCTTGCATTCGATCGGCTCATTCTCGATTTGGATTGCGCGA
GTGCGGGAGGAAGCAGCAGCAGGCCGAGATCAAGTACCGACACCATGCGCTATCGGGAGGGGCTCGCGCTGCTCCTCAGCACGACGATGGGGTGGAATCC
GCTCGTTGCCGGTACGACCACGTGGCCGACGACGTGCTCGGACGCGGCGTCATTGGCCTGGCAGGCCACTTGCCCCGCGCGAACTGCAAACAACACCAAC
TACGTCTCGCCTACCGGAATGACGTCTGCGGAGATCAACGCTGATGAGCCGAACGCTATCGTAGCATACAAAACGGCTCGTCAGAGTGCGCTCAAGCTGT
CCGCCGTTGCGGGCAACACTGCGATGGCGGGACTCCGCAAGAAGAGCAACAGTTGGTACAAGGACTCATTGACGAAGTTCACCACGTACATATGCGTGAA
GTCCTCGTCAGACGCAGAGCTGGAGCGCTGCGTGGATTCGTCAAGCAGCGATGCTGTGCGAGACATCAACGGCAAGTGCGTCGTCATGCTTGACACGGAT
TCCTGCAACAGCAAGGGCAAGTGCGAGCGCCGAAGCAACTGCAAGTGGGACGATGTTGTGCCTAGCGGGACGGACGCCCGCCGCCAGCTCTTCACCGATG
CCGATGTCACAACTGCGACCAAGTGGATGTCGACGGGATATCCCAGCTCGCTGGCGCCGTTCGTGGCCCCCGGTACCGTCATGGGTGTTCTCACTGCGCT
TGGCTGCATTGGTTTCGTTGTGGCTCGATGCATGTTCAACCAGTGCGGTGGTCGCGAGCCGAGTGAGAAGGGATACTCTCGCTGCGATATCATTATCCCG
ACACTCACATTCCTCGTGTGCTCGCTGGCCGTCTTTATCTGCATGGTCATCACTGCTGCGCTGAACACCAACATCTCCGATGGCGTTGAAGGCGTGCTGT
ATTCTCTGAAGGCCACCCTGGAAAATGCGAACATCTTCGTAGCTAACCTGCTCGTTCCACTGAACAATGCCACAACGGAGCTTGCTCTTGCGACTAAAGC
AGTGAACTCCCAGCTCAAGAACTCGGACTGGATCGCTACTGATGGCGCTACACTCAGGCAAATGCTCGCAGAATTTGGTAGCATTTACTACAACCACGGT
GCTTTCCCGTCCCTGACGTGCGATCCTACCAGCAGCGACACCTTTTGCATGGCATGCCCCGACAGAGTCTGCGGCTCACCGGTCACGTTCTTCGTGAACA
ACAGCGACGCCGCCATCTCTGCTAGTAGCGACATCGTTGGAGATGCGGTCGGCTTGCTGTTAAGCTCGCTCGTGACTGGAAGCACTGCTCTTGACACAGC
TCTGCGTACAGCGGCACGTGATATTGCGGTTTTGGGCGTCACAACGAACAGCTCCATGGACGTCGTTGATGTACTCAGCAGCACCTTCAACAATCTGTCG
TTCTCCCGCAGCGCTCTCGTGGTCTGTGTCTTCTTCTTCGGCATGATCGCATCGATCCTGGGCATCATTGCAATCGTCAAGAACGCTTGCACTGCTAAGA
CCACCCAGTGGGTGCACCTCTTGCACGTGAGCTGGGCACTAGGTGTGCTCGTGGCTGTGCTGAGCTTCGTCCTGTCGGCATCTCTCCTTGCTGTCGGCGC
TGTATGGTACGACTCGTGCGAGTACATGAAGGTGCTACATCAGGACATGTCTCCCTATGCATCCACTCAGATGTCCGCGATGGCGAATGCTTGCTTCAAC
GGTAGTAACATCCTCACACCGCTCGGACTTGACACCCCACTATCGTTCTCCTGCAACGTGGAAGAGGAATACGCTGTTGTCAAGGCCACCGATACGACCA
GCGTGCCGACCATTATTGCGACGTACGGCCAGATTGTCTCGAACTACGACCTCACAGACTTCAGCTTCAACTCTACGCGCTCACGAAGTCTCGTGTCCAA
ACTTGCTACCGCAGCGACAAAAGCAAATATCACCGCAACCACGAAGTTCACGACAGAAAACGTCTTGACCCCGTGGTTGGCGTACAACCTACCGTCCACG
AAGTACAATTCTCGTTGTGCCAACTCAACCGCTGACGTGCTGCCTGTGTGCTTCATGAACGCGCATTGTGATTCTAAAGAGGCTGGAAGCCAGCCCCAGG
CTGCCTGTCAAGTTGCGTTCAGCGACGCCTACCAGTACATGCTGGCCTTCGACAAGGCGAGCACGATGCTGGACGAAATGCGCGAGGCTCTTCTGGGCGA
CACGGGCAAAAACTTCCCAGAGCAGTGGAACTACTCGGTGTCGATCAGCGAGTTCGCCACCAGCTACTTTTCGAAGATCACCGCTCTGAAGACTGGTCCA
ATTTCGACGATGCTGGGAGATAAAGGTGTTGTGCGCAACCTGCTGACCTCAGTGGAGCAGGCTCGTTGCTCGGGCGACTGCTCGTGGACCAATCTATCCT
TCGACGCCATCAACGAGGCTCTGTGCAACGACGTGCTGGGCACGACACTCGCCATCTCGCTGTGTGCGCTGTTCCTGAGCCTGTTCCTGCTGCCGCTGAT
CGTGTCGGCCATCATCCTGCAGAAGCGTCTGCGCGGCGTCGCCAAAGGCACGTACGACCAGCTGGAGGCGCGTCTGCAGGAGCTCGAGCGTCGCGCCAAG
CAGCAGAAGCAGGAGACCGAGGGGCTGGCTCCCGGCGGAGAAGGTGCTAAGTCGGCCGGCGGGCTCGGCGCTCTCGGTGGCCTCTTCAAGGGCAAGAAGG
TCCAGTCGCCGAGCATCTGATCGCTCACTCACCTCTACGCCTCGTAGTAGAACCTCCTCTCTATTAGCCGGGGCTGCGCTCCAAGGTAGAACGCAGTCGT
GCGGTCAATTTATACCAATACACCCAAAGTCATTGCATCCTTCGCGCAGCTTGTTGCCTTTTGTGCTGCTCGCCCATTGGTCCGTCCACTTCAATCCGTC
CACTTCAACTCCAAAATACCGCGATCTATACCGTCCACTTCAACTCCAAAATACCGCGATCTATACCGGTTCCTTACCGCCCGCGTGTCGTATCCATGTT
GAACCCGCCGCATTTCTACCAACCAGGAGCAGTTCAAATCCCCCATTAGCCAATTGACGACGTCATGGCCGGAGCTGGAGCTGCGCGCGACGTGGTGGTG
CTGGGCGGCGGCATCTCGGGCCTGACGCTGGCCTACTTCCTGCGCCAGGCGCTGCCCAAGGCGGTGGCCGACGCCACGCGCATCCGCGTGCTGGACGCGA
GCTCCGTCTCGGGCGGCTGGGTGCGCACGGCGCGGCGCGACGGATTCCTGTTCGAGGAGGGGCCGCGCGGCTTCCGGCCGTCGCGCAACGGCGCTGAGAT
GCTGCGCCTGGTGGAACAGCTGCAGCTGCAGAAGCAGATGCAGGCCGTGGACCCGGCGGCGCACGCGCGCTACATCCTGCGCAACGGGAGGGTGGAGAAG
GTGCCAGACTCGCTGCTGGAGCTGCTGCGCTGGCCGCTGACGCTCCCCGTGGCGCGCGCGGCGCTACGCGAGCTGTTCGTCAAGCCTGCGGCGGTGGAGG
ACGAGTCTGTGTACAGCTTTATGGCCAGGAGGTTCAGCCCCGTGGTGGCCGAGAGGCTGCTGGACCCCATGGCCTCCGGCATCTTCGGCGGAGACATCCG
GAAGCTGTCGATGCGCGCGTGCTTCCCCATGCTGCTGGATCTGGAGAGGAAGCACGGGTCTGTGGTCAAGGGCATGCTGTTTGGGGGTGCCAGTGGGGAC
GACACGCTGCTGGACGGCACCAAGAAGTCGGACTTTGTCAAGAAACACGAGAAGTCGGTCAGCGTGAGCTTCGCGGACGGGATGAGCACGCTGATGGACG
CTCTGGCGGACAAGATCCAGGCCGACCCGATGGCTGGTCTGCTCCTGAACACCAAGGTGACGAGGCTGGAGGTGCACGGACACAACAACGGCTCCACAAA
GGGACCGAGCTTCGTCGTGGAGAGCAAGGACCCCATCTCCGGTGAGATCCGCGAGCCGATCAAGGCCTCGCACGTGTTCTCAACTATCCCGGCGTGCTAT
TTGGCTCCGGCTGTGAAGGACTCGGCGCCTGGACTGGCCGAAGCGCTCGACGAGATCAAGTTTGTCGACATGGGCATGGTGCACGTTGGATACAACGACA
AGGTGCTGCAGACCGAGGGCTTCGGATATCTGATCCCCACAGCAGAGCGCGAAAAGGTGCTCGGCGTCGTGTTCGACTCCAACACCTTCCCCGTGCAGAA
CGCAGAGGGAAAGATGCAGACGCGCCTGAGCGTCATGAGCGGCGGCGCGCACTTCCGTGAGGTGGCGTCGCTGCCCGAGGGAGAGCTGGAGCGCAATGCT
CTGGACGCCTTGAAGCGCCACCTTGGCATCTCGCGCAAGCCTGACTACGTGCGCGCCATGGCTCTGACGAATGGAATTCCCCAGTACCACGTTGGCTTCG
GCCAAACGCTCCAGCACATCGAGAAGCAGGCTGCACGCAGCGCTCCAGGCCTGTTCCTAGGAGGCAACAGCTTTTACGGCATTGGCCTAGCTGACTGCGT
GACGCACTCAAAGCAGCTCGCGCTCAAGTTTGCCAATAGTGTGTCGTCTTGAGTTGTTAGAGTTTGGTGCATGCGCACATTTTGGTGTCCGGAAAGTGTG
TGCGTAGCGAGGTATCCCCGCACAGCGGCGAAAATGAACATGCTGTCGCTGTTCTCGTTGTTGCGTGTTATTTACGCGAGTGTCTCCTGCGCTGGAAACG
GTTTTGCTTCATTTGCAAGCGACCGGTCGATCTTTCAGTCATATCGCCGTGCTGTAGCAATATGTCGCGGACGGTGCCATCGCGAGCGCTGGATCCTGTG
TATGGTACGTCTCATGACTGCGTCATGTAGATCTCGAGATGAACCTAACTGTTGCTTCATTCCCGCCTGCTGTGCTCTGTAGATACTGTGTACACGGTCT
CCAACTCTGGCGGCTCGTTTCGCAAGGGTGTCTACCGATCATCGTCGAAATCTGCAAGTACGAGCAGCACCCTCAGCAACCAGAACCCAGCCGAGGGCAG
TCACCTCGTTAGCGGCAGCCAACGCGTCAAGTTCCACCGTAGGCCAGTGTTGCCGCACTTGCAAGCTGAACCACCCGAGGTTTTACTTGCTCCAGTATTC
GCAGCCCCAGCTCCGCCTGTCAAACGCCAAGGGCCCACGAAGTCGTCGGTGTCCTCTTATATTGCTGCCGATGCGGCTGATGGAAATACGCGGTCTGTGG
GGATCCAAACCGCTTATCGTGACTCGGAGGCACAAACAGACCCGTACACCCCGGACTACACTGTCCAGAAGACAGCAAATGGTTTGAGTCCCGAGATTTC
AACACTAGGTGGGCTGAGCCATGCTCGTGGACAGCTGCCAATTGGGCAGGCTGAACTTGAGCTTATCGAACGCAACCGGAAGAAGCGCGCGTTTGAGGCA
TCACTGCCACCCATGACCGACGAGGCCAGCTTTTTGCTACGCAAGGCGATGCTGGAAGCTCAAGAAACTCGTGAGTGGGCGTACCGCGAAGCCGAGATTG
ATGCTTTTCACGATCAGCGTGTGGCTTTACTTGAGCAAGCGCTGGCGGAACGTGAGAAAGAGAATGCATTCCTCTCAGAGCAAAGGCTTGAAGCACTACG
CCAACGACTACTTCATGAAAAGGAAAACGCACTTGAAAGCATTCAACAACAGCGTGTGGCAGCTCTGCGCAAATTGACGAAAAAGCGTGCTCAGCGGCAA
CAGGAACGTGGGTTTGGGGCGTCTCGGCCTGAGCGGGGACGTGACATTATTGCTGAGTACGCCAACTTTGGTTCGCAAGTGTATGCTCCTGTCACCAGAG
ACGGTAAGGCGGGTAAGATTGAGGTTCGAGAGTTAGGTATTGGCAAGCCTCAATTCTTGCAGCTTGATGCGTTGCGCGAGCTTGAGAGCGCTCTACCCGC
GCGAATGTTGCTACCTGCATCGGGTAAGTACAAACCTCGTGAGAAGAGCGGGCGCACTGCCAAGGAACGGAAGCAAGCAGCAATTGAGGCTCACCTCCTT
AAGATGGAGTCGATCATCAAGAAAAGCAAGGAGCAAGCCGATGGTGATGACAATACGCCCGACACTCCTGGTCAATTGCGACAAAGTGCCTCCAGCCCGC
TTTCACGGCATGGTAGTCAAAGACAACAGACACTGGTTCGTCCACCCACACCCGACTACGCCTTGGGTCATGCCACTGACGCACAGGAACACGAGGTGGA
GGACGCTGTGCGCTTGTTGCAAAAGCTGCTACGTGGTCGCGCTGTTCAAAATATGATGTTCGAAGGCAAGGAGAGACGCGCAGAGCTTATTGCCGAGCTG
CGTGCAGCTGACGAGGAGCTGGCAGTGCAACGTCGTCACGAGTTTGAGTTGTTACAGGGGTCCGGAACGGAGGCGATTGACAAAGTGGCAGGTGCCGCGA
AGACCCGGGTGGAGGGCGAAGTGGTGTCTGAAATGCTCGACTTCTTGTCGAAAGAGCTGTCGCGGTCGCGTGAGATGGCCAAGATGCGTGCGTTCGTGAT
TAAAGCAGCGGAGCAGCGACGAGTGCGTGAGGTTGAGGAAGGTGGGCGACGGCAAGCCGAGGATCTGCTACGTGAGCGTGAAGATGAGGTCTTCCGGCGC
GTCATGCAGGTGCATCAGGAGACCTCTCGCGATTTTGTGGACGACGTGCTGGAGGAAGTGGCTCTCGAGCAATCTCACACCCAAGCATTGCACGAGCTGC
GTGTGCGTAGTGCTGGCGTGGACGGCATCGTGCTGAAACTCGAGAATGAATTGGATAGTGATGAATCCGTGGTGCGAGAGCTGGTAGCAAGCTTCTTGCT
GCCCCACGTCCAACGACAGCAAGTACGTCGCCAAGTCACACAAGAACAGATGAAATACGTTACGGCGGCACACGCACTTCTAACCGAGATGGCCACTGGC
ATGAGTCAACCGAAGCCTGACCCCAGTGGCGGAGAGGGCGGTACAAGTTAAGCTTAGGATGGCAGTGATTGAGTGCGAGGTTGATCGAAACGAAGTACTA
CGAGGTATCGCTACCGTGTTGGCCAGTCAATGTTGCTACCTTGACTTCAAAGTTTTGAAAGTGCCTGTTCCATTATCGGTAGTCCTAAACTACTTGGCAC
CCGCTGCAGAGATACCTGTAGTGCCACCTCCAGCAGACTTGAGGAAAGCGTCAAGGTGCTGCCCTTGGTACTTCAGGAAGTCCAGCTCCTCTTTGAACTT
TTTCTCCTGCAGGGCCTTGCGCTCGGCTGCCCGCTTCTCGATCACCTCGAGCTTGTTAGTGAGCTCAGCTACCTTACTCTCGCTCTCTTCCTTGTCGCGT
TGAAGGTTCGCAATCTGCTCCGCCAAGTCACCCATGCCGTCCTCGGCCTGCAGTTGTTTTCGCACACCAAAGGTGAGACTCGAATCGTAGAGCGTTTTGT
ACGCATCTGTGGTGAGTCGAAGCTCATCGCGCACACGTAGTAGTAAGAGTCCTCGCTCCGGACAGTTGAGGGTCACTTCACGGATAAGTTCATCGAACGC
TTGCGAGTACAGATCTTCTCGGACAGGGCAAATACCGCTCTCTCGAGCTTGTCGCTGCAGCAGCTTGGCATCAAGTGCTTCCTGCAGTTTCAGCACGTCG
AAGCGAGTCGAGGGCACACTTGACGCGTATCGAAGCCAGAATCCCGAGTTTTCCTCGGACCACATCCTGAAAGTAGCAGCATCGACGAGTCAGTGCAGGC
TAAGACTATTGGCACAATGGCGACAGTGAAGAGCGTACTGCGGTGGTAGAATGGCATTCAGGATATCTTCGACCCGAGCTACGCCATCGGAGCCCTTGCC
ATTTGCTGTCGATCCGGCTGATTCAGCCGCTGCTGCCACGACAGTCGCTGCAGTGATCGAGTTCGAGGAAGAGCCCGCATTGACACCCGGCACCTTCCTG
GGCGGATCCAGCGTCTCGCCCGTGAAGATTGGATCGCCATACTGCACGAGCGATTCAGGAGGAGTTGGCGTCGACATCGCTGCAGAATTCCCAGAGTGAA
CTCGTGCTGTGTGCGTCTGCTAGCAACCGTCGCGTCCGTTCATCAAGTTCACCAGACAAAATGCAGTTTTTGGAGTTGTTCAGAGTTATTGGCACTACGA
GCTACACTAGTGTCGCTGGTTCGACTTGGCGGCTACCAGATCCTGTTTCTCCTGGCGCTTGCGCGCTGACAGCTCCTTGGATAGTTGTTCTGGATTTTTG
TAATTCTCTTTGGCGCCAACTTTCTGTCGCCACTTGTCGCTGTTAGTTTGGCGAGCTGCCTCCAGTACTGCAAACTGTGCGTCAATAAACAACACCCAGT
CAAACTACGTTTTCACCTCCCCGGACACAGTATCCACATACGTGATCTCTGCGAACGCTCTTCGTCAGCTCAACAGATTGATTCCAGGGTTTGGCGTCGT
ACAGGTCTGGGTGGTTCGGCAGCTCCTCTGTGCACTTGGCGATTCCCTGAACAAGCAAAATGATGTCTGTAAACCGACGAAATGTACTCATACACTCCAA
AACTGATGCGCACACATACTTTCATCACACGCTCATTCCCGAAGGCTTCGCCCACATACTCGTCCTTCAGAGCCACTTCCAGAATACCTGTGTTGAAGCG
GTTTGATTTAGGCTTGAGTGTTGGGTTCTTTATGGGTAGTTTCTCGGCACGGAAGTTGTAAGCAAACATGTGGGCGCGATTTCGCTACGAAACAAGATAA
ACACTCTAAACTTCAGCTTCCCTAGATCATTTCTGTAGCAAATCGATCAAGCGTACCTCGGCATTGATATTGGTTCTCTTGTAGCACTTGCCCGCCATCT
GCATGTTGTCCCAGTTCGAGTTTGATATGTTCCATTCAGGTCTCTCCGCCGAGAGAATACGAGACCGAAGCATTTCGACAACCTCCAGCTTGGCCGCAGC
TTTGTCAGGTGCAGTATCGCCTGGACAAAACACCCTTTCCTCAAAGGAGTAGTTGACAGGTGCTTCTTTGCTGCCGATACGCTTTTTCGCGTGCAGAAAG
CTGACCGATGTGGTGCTCGTTGTATCCGCTGAAGGCGAGACATCTGTAGAACCCCTGTTGTTCGCAGCAGACTTCATGGGCGCTGTCACTTGCTCCTCAC
CAAATGTGCCTTCGCTTGGTGCGTTCGTGCACACGAAGAAAATCACGCATAGAATGATAAGAGCCTGGGGAGGCAGGGATCTATTACCGTCGACAAGTCT
TGGATCGATCCGCTATATTTGGTCAGGCCTGTGCATGTGCACACACTTTGCTTTGGAGATACGCTCGTGGCATCTTACGCTGATTCGGTAGCAGCAGCAG
TGGTTTGAACTTGCTGGGCCTGTCGGAAGTTATTGCGCTCCGCTTGGAGGTGACGACACAAACTTTCCAGCTTCTTGAGCTTCTCCTGCAGCTTCAGAGT
CTCCTCCGCGGATGCCACCTTCTCCTGAATAGAAGCGATCGCGCCGCTATCGTACTCGGCGCACTTCTTCCTGAGCGCTAGGTTTTCCTTCTCTAGCTTC
TTGGTCGTTTTGGCCATCTTGTTCATCTCCTCACGGAAAGTAGTGAACATCTGATTGCTCTTGGTCAGCGTTTCCTGCACCACGTCGAATTTCTCAGAGT
ACGAATTGAGCTGCGCCTGCAGCTGAACCTCGCGATCGGAAAACTCTTTGGCCTTGTCCAGTGTAATCTTCACTTTCTCGGCCTCACGCGTGGTGAGTTC
TACCTGGTGTTGCAGCTTCGTCTCCGCTAGCTGAACTGTCAAATCCTTAGCCTCTAGTTGGCGCTGGAAGTGCTCTTCGCGCGCCGTATATTGCTCGAGG
AACGCCTTCAACTTCTGCTGAAGACTGCACACATAGCATAGGAAAATAAGATTCGAGTCGAGGGGAATAACTTGATGCAGGAACGTACCTTTCGTTTTCT
TTCAACGAGGCCACGTAGTCCTGGCCCTGCTTATCCATTTTTGCGCTCACATCTTCAATGGTTTTCTGAAACTGGGCGGAAAGCTCGCGCCTGTGTGCAT
GGCAGGCATTACGCAGTTGGGAGAAGCACGTTCAGGCGTCTGCAAAATAACTTCTATCTCAATCATATATTGCCCAACATACCTCTTTTGGTCCTCTTCA
TCTGCGATACGACGGCTTTCGCTCTACGTAGAAACACACCACGACTGTCACATCCCCAATCGGATCCACAAATTCCCAGCGTAATGCGTACCACAATGAG
CTTGTTTTGCTTCTGCAGTTCCCGACAGAGCTGCTCCAGCTTGGCCTTCGATGTGTTGGTCTTCACCAGCTCCGTGCTCACTGCACCAGGACAAGAAATT
GTTAGCATAACGCGCTCGTTCCTCGCTCCATCCCAGCGCATCAACGCCCGCACCCGCGCTCTTGCGTTGCTTGAGCAAAATGCACTTGGCGTTAAGCTCG
CCGATTTTCTTCTGCATCAGCGCCACCTGCTCACTCTGCAGAGACCCACACCGTCCCGTCAGCAGCCACCTCAACTCTCTCCTCAACACACACAAACACG
CCCGCACCGCCTGGCTGAGACTGCTAACGAGCTCCGCCACCTTCTCCTCCGCCGGCAGCGACTCGTTCTCCTTGACCGCCTCCGCCTTCTCCTTCAGCTG
CACGGGCAGCGCCTCGTCCTGGTAGATACCTAGCAACGGCATCAGCATCGTCCGCATTAGTTTGTGCAGTCCCTCTCTACTGTTATTGCGCCGGCCGCTG
CCCTCACCCGAGAGGTCGATGGGCATCTCCAGGTTCTCCTCGCCGCCCACTTCGATCTCCGCGATCTTGCCCGCCAGCAGCTCGCGCAGCGCGTCCTCGC
GGTTGGCCTTGGCGCTGCGCTTGGCGTGCACGTGGTGGCGGCCGGGCGACGCCGCGGTGGGCGAGCGCTTGGGCTCTCCTCCAGCCTGCTTGTCGCCGCC
CTCCTTGCGCTGCTGCTGCTTCTTGCTCTTGTGCTTGTGCTTGAGGCTCTTGGCCTCGCGCCCGAGCTGCTTGAGCTCCAGGCTCGGCGTCTCCATCGCG
CGCGTCTGCTCGTCCGACATCTTTGGCTCGTGGCCCTCTAAGCTTTCGCCGGCGCGATACCTCATCGTTGCAATTTGGTGCACATGTATCGGATATAACG
GTGCTATCAGCCATTGTGATGACGTATCCGAAGTGTGCTCAACTCCCGTTGCTGGGATCACGTTTCACCGGGAACGGCCTGAATTTCGAGGGTTCTGTGG
TATTCAATATCGCGTTCAAGAGATAATGGAGGGTCGCGGGGCTACTAGCAGCGCGACGACCGTCTTGAGCACGCCGAGCACCGCTGCTGCATCTCCACCG
AGCGCCGACACCTCGGTGTAAGTGATCTCGTGCTCGTCACACCAGGCGCGGGCAGCTTGCTGCTCTTCTCGGCCACCTTCATCGATGCAGTCGCTCTTGT
TGCCAACCATGACAACCGGCAGAGCCGTTGGCGGGCAGCCCTCAATGGTTTCGGTCGCCGCGATCTCTCGACGAGCTACGTCGAGGTATTTGGGCAGATC
GCGCCAAGAGGCCGGCGCCTGCAGGTCAAATACCAGTACGATCGCCTGGGTGCTGCGAAAGTAGCGTGAGAAGATGCTCGAGCCCGCGAAGCTTTGCGGC
GGCACGTCCCACAACTGCGAATCAGATACCAGTCCAGCACGGCAGCAATTCAGCTCGACACCACCGCAGCAATCGAACGGGGCGCACCTCCACCACCACT
GGCTCGTGTCCCTCGAGACGAAGCAGCTTGGCGCCTACGCTGGCTACATTGCAGAGCACACACACGCAGAGTGCAGCGAGTCAACGTGGAGTGCCTTCCT
GTCCAGTGGCTTCTCACGCGCCAGCCAATGGGCCTCCGTTTTCGCGCGTGCTCACCCGTGGTGGACGGCGTGTACTCGACGTCGAGCGCAGTGCCGATCC
AGCGTCTGAACAGCGCTGTCTTGCCCACGGTTGCGCCACCCAGCAGCACGACCTTAATCTTGTCGACGGATGGTCGATCCGAGCCTTTATCTTGCGCAGC
GGGCGCGTGCCTCCGCCGGCTGCTCGAAGCTTCATAGCACCAGGCAATTAA