Description :
From Genome Similarity Track
Location :
Scaffold_499:7571- 13152
Transcript NameFunction/comments
g15272.t1ETI34642.1 hypothetical protein F443_18889 [Phytophthora parasitica P1569
g15273.t1hypothetical protein

Sequence
5581 bases(100 bases per row)
CACAACTCGATTTCTCCTCTTCCTCGCAAGTCTTCTGTCCAGCAGGCCAACCCCTTGACAGGTTATGAGCCCAACGCAAGCCTCGCCCACCGACGACCGT
GACTTCCCGCGCCTCAACGGCCGGAACTTCGTGATCTGGAAGACACGCGTCACCGCCGCACTCGAAGGCAAGAACCTCATCGGCTTCGTCACTCAAGCCG
ACTACGCGGGGGAGTCTGAATCCGACTTCAGCGACGAAGATGAGCTCGATCCCAAGTACTCCACGTTCTTCACGGCTGAGAACAACCAGGCTGTCAAGAA
GACCCTGGACGAGATCGGCGCTCCAAGTGCAGATGCACCCAGCTCCTCATCGAGTGAAGCCTCGGACGACAGCACTGCTGTGGCCAATGAAGATGGAGAC
GGAGACGTTGAGATGGACCAGGAGAATCTCCCTGTGATCCAGTCCTTCACTGCCAAGAAGCAGCTGGACCGTCAGAAAGCAGAGAGGCAAAGGGTCAGAC
GCCCCAAGTTGAGCTCCAAGACGCTACGCCGGATGGAAGCGAAAGCTAAGGCTTTTCTCATGAAGACCATTGACGACCAACATGTCCTCATGATCAAGGC
GAAAAAGACGCCGTACGAGATCTTCACGACTCTGTGTGCCATGTACGAGGACACTGCCATCCACGGAGACCCGTACTACATCATGAATTATCTGATGGCT
CTGAAGTACGAAGAAGGCACCGATCTCAACAAGTTCATCTACGAGATGGAAGAGGGAATGAAGGCAGCCTCCGACACCACCAACAGCGTGATGACAGATG
AACAAAAGACCATATACCTATACCACGCCTTGCCTGATGTCTGGAAAGTGGAGATGGCAGCTTGGAAGGGCAGTCGCAAGTATGTCCCGTACGAGGAACT
CAAGCGGCACATTGAAACCAAGGTCCGAAACGAGATGGCGCGCAGTCGCTACACTCTAAAACAAGGGACCCCAGAATCTCGGGAGACTCAAGCTGAAAAG
GCCCTGCAAGCTGAAGCGCCAGCCAAAGTGGAAACACCACCGAAGAAGGCGACAGTTCTTGTGACGACTCGTAAGTGCTCGTACTGTGGACGCGAAAACC
ACGACACGGTTGACTGCTATATTCTGCAGCGTCATATCCAAAGCGGCCAAGTCAAGGAGGGAACCATCCTACCAGCCAATTTCAAGCTGAAACCTTTTCA
AGGAACGCAACGACAGCATCCTTACAAGGGGGACTACAAGAATCGCGGTGGAGACCGCCAGCCTCGCAGCCGCTACAACAATGGCCGCGGAAACGACAAC
CACAACGAGAACGACAGACGCCACAACAATCGTGGACGCCCCGACCGCCATGGCCGTCAAAGCTTCAACAAGTTCCGCGGAAGACGCAACAAAGAAGACA
ACGCCTCTGACGGTAGCGAGTATGGCATCATTGCTATCACCACGCTTGATCTGACTCCGATGAAGGACGAGATCAGCCTTACGGCTCAAGATGTGCCCCA
TGACCCCGCGTGGACGATCGACTCTGGCTGTACCCGCTATGTCACGTCCAGTCCTCACTGGTTCGAGGACTTGAAACCCATCATTGGTAAAACCATCACT
GTTGGTGGAAACCACCAGATCCCAATTCTGGGCAAGGGCACTGTGAACATGACTGTCACCGACACCAAGGGAAGCAAGCGCATCATTTCACTGAGCGACG
TGCTCTACGCGCCCGAACTCAAGTTCAACTTGCTCTCGGTGCGCCAAGCCGTTGATGGAGACTACAAGATCAACTTCCCCAACGCCAAGAAATGCGTTCT
GTTCTACGCTCACCGTACCAAATTCGAGGCCAAGACTGGAGAAGGAACCAACCTGTACCAGTTCAAGGCTCTCCCAACTGACAGTGACCAAGCGGCCCAC
GTGGCCAACACAGGTAGGTCCGATAACATCATGCTCTGGCACAGACGAATGGGTCATCCTAACTTTCGCATTATGCAGGATCTGGCTAAGACCGACAAAG
TTAAGGACATAGGATTGTCTAGATTCGACTCTAGCAAAGACTACTTCTGCTCATCATGCACATACGCAAAGTCGCACCGTAACCCGTTCAATAAACGATC
CGTTGAAAGGGCGAAATTCCCTCTTGAAAAGGTCCATACCGATATGGCTGGACCATTGCCAGTTGCAACACTCTCAGGCTGCCATTACTTTCTCACTTTC
ATCGATGACTATTCACGCTATATGTTTATCTACCTCATCAAGCGGAAGTCAGACCTCTACGAATGCTATGAGAACTTCAGAAAGAAAGCTCTCAACATGT
TTCGCGCTGACGTAGGCCAGCTCGAGTACACCGAGAACATGTACGATGAAGAGATCCGTCACCTCCAAAGCGACAACGCTCGAGAATACGAAAAACTCGG
TCGAGTCATCTTTGAGAAATACAACACACACGCTCAATTCACGAATGCCTACACCCCTCAACAAAATGGGGTCGCAGAGAGAAGGATGCGCACACTACTT
GAACGAACACGAGCCTTCCTAATTGATGGAAACTTACCACACGTTCTCTGGGGAGAATGCGTGAAACATGTCACTGACCTCCTGAACATCACTCCAAGTT
CTGTTACGGACAATATCACTCCTCATGAAAAGTGGTTCAAGCGCAAACCATCCGCCCACTACATCAAAGTCTTTGAGTGCGCGGCATATGCACACATTCC
AGAACTCTATCGGACCAAACTTGAAAAACGAGCGAAGAAATGCATATACCTAGGTATTCCGTCGAATAAGAAGGGGTACAGACTTCTCGACACGACCGAA
AATTGGATCATCTACAGTAGAGATGTTCAATTCCGAGAACTGGAATTTCCTAAGATAGATTTTCTTCAATCTCCGACCACGGGAGACCTACTCAGACCTA
GCGCTGAAACCACAGCACCCACACCACAACCACTACCATCTCTCGTTGAAATGCTCAAACGCAGCGCGACAGCACTTGCAGCTGACGACAGCAAAGGTTC
GAACAAAAAGGCAAAACACGCCCAAGAACACACAGATCTAATACACCTCCTCAATGATCCACTCGATGTGGAGGAACGACGAGCGCTGGAGGGACAAACG
TACTCATTGCTGGCGATCCGACACATTTCGGAACCAAAGACATACCGAGAAGCAATGCGTCTACCCGAAGCACTCCAGTGGAAAAATGCCGCACGAGCCG
AGTATACGTCACTGATGGAAAACAAAACGTGGCGACTCACAAAACTACCGAAAGGAAGACGATCATTACAGTGCCGATGGGTGTTTGTTGTCAAATACAA
AAGTGATGGCACGATCGATCGCTACAAAGCACGACTGGTGATTAAAGGATTCCTTCAAAAATACGGCATTGATTATGACGAAATCTTTTCACCCGTTATC
CGCATGGAAGTCCTCTGGCTACTACTCACCATAGCAGCTCTTCTTGACCTTGAGATCCATCAAATGGATGTCAAAACGGCTTTCCTAAATGGATTCCTCG
ACGAAGAGATTTACATGGAGCAACCCGAAGGTTTTACCACTCGAGGGAAAGAACATTTGGTATGTAAACTACTGAAGAGTCTTTACGGTCTCAAACAAGC
ACCTCGGATCTGGTACCTTACACTATGTACTTTTCTGGTAACCATGAAATTCCGCAAACTCTCCAAAGACCAATGCGTTTTCGTTGGAGAAGTCGACGGA
CATACGTGCTACATCCTAGTCTACGTTGATGACCTTCTTATCAGTGCGCCTTCAGTTGCTATCGTTATCTCCATTAAGGACGCGCTCAAAACGCGCATCA
ACATGCCTGACCTTGGCGAAGCTCAGTACCTCCTCGGTTGGTCGATCATCCGAAACCGGAAAAACAGATCCATCTTTATCCACCAGGAGAAGTAAGCTGA
ACCGCTTCTCTCATCTGAGCTCCTACACCAACCGATTCGAGTACCAAACTCTCACTTAACATGTGCCCTGCAACGCAGGCGGAGAAGGATGAGATGTCTG
CGATCCCGTACAGAGAGGCAGTCGGTAGCTTCATGTATTTGATGATGGGAACTAGACCAGACCTAGCTTACTTCCTTCGAGAAGCCAGTCAATTCCTCGC
AAATCCAGGTAAAGCCCATTGGAATGCGGTCAAGAGAGGCCTAAAATATCTCAATGGCACCCGCAACTTCGGTATTACCCTAGGAGGTATCCAAAATGTT
GAGCTGTATAAAACGCAGCACTACCTCACAGCCTTTTCAGATGCGGACTACGCCAACTGCCCCGATACACGCCGATCAGTAGGCGGATACATCACATACA
TGTGTGGAAGCCCTATATCGTGGCAATCTAGAAAACATCACACAGTCGTGCTCTCCACAACGGAGGCAGAATACATCGCTTTATGCCACTGCATACAGGA
ACTGATATTCCTCAACCTCTTGCTTACAGAAATAAACCACACCAGTCCTCATGCAATCACCATATATGAGGACAACCAAAGCTGCATCAAGCTCTCATAC
AACCCCGAATTGCATGGCAGATCGAAACACATTCACATTAGATACGCCTTTGTACAAGAGAAAGTAGAGAGAAAGGAATTCTCGATACAGTACTGCAATA
CCAAAGAAATGGTAGCAGACATATTTACGAAGTCACTTACGAAGCCAACGTTCCAACGACTACGAAAAGCTTTGTGCAAAGCACCACTTTCATGAAACCA
CAGCTAAGTAGTTGAAAAATCAATACCTTTAAATTACAAACAAACAAAAAACAGAAAAATATGAAACTGGCTTCGAACTATCAACCAACTATTGAGAAAT
TGATATATTATTGGCTCAACAGGAAAGGGAAGCAAAATATATTGTACCAATTATTGAGTACACTTCTTTTTACCACGTCTACGTTTACGAGTTTTCTTCA
CAGTGTGCGGAATGTCCTCAATGGAGTATACTCCGTCGATGAACTGGAAGTAGGAAGTCAACTTGGTCACATCGTTCGAATAGAACATGTAGTTATCCGA
CTCAATGAACAAGTGCTCTTTTCCTACCGTCGCCCTAGCAATACAATGCCAAGTACCTTCTTGTTGACCGGGGCGCCGACCGATGATGAGGAGGGCAGGC
TTTTGCGATCGCACAATGTGCTTAGCGCGACTGCCCTCGCCGCTTGCGAACCTTTTGTTCATGTAGATAAGTCGCTTCTTAAAGCCCTTCAACGCCAAAT
GCATGGCATGAGTTGAGTATGCCCCATCACGGGGGTGACCATGGTCCTCATCAGGACGTTCCTTCTTGAGCTTCAGAAGAACGGTTTTCATCGCAGCGCA
AGTCAACAGGTCGCGCTGCTGCAGAGCGTTGTTCACTGAGAACAGTCCACAAAAGGAGACCCGCTCTGGCAGCGCTTCCTGGTTCTGGCAAATGATCCTC
TGTCGAAGAGAACGAGGCATCTAAAGCACAGTTGCATTTAAAGTCAGCATCATTTCAGACCAAATTCGGATTATAAATGAAGCAATCATATCAGTACAAA
AGCAAATCCGAGCGATGAGGCCCTTTCGAGCTGCAAACCTTTTCGGTCCACAACTCTAGCTCAGCTGCGACGCCGTGCAGG