Description :
From Genome Similarity Track
Location :
Scaffold_382:7571- 17907
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_382-snap-gene-0.4DnaJ (Hsp40) homolog, subfamily C, member 13

Sequence
10336 bases(100 bases per row)
ACGCATCTCCAGTTCACCTATTGAACAGTCCCCAACGCTTCGGAGTTTGCGACTTGTGGCGGCTGTAGAGCGCGGTCGCGCGGCGGCCTCGTCGAGTGCT
CGTGAGCGACATGAGCGACGAGTTGGTCGACTGGCCAGTGCTCGGTGTCTTCCACGAGTCGAGCAGCGAGTACCGACGCTCTGATCCGATCTCACTTGCC
ATGCCACTCCTTGGGAAATTCTGCGTTGAGTACTGACTGTCGTTCAAAGTCGAAGGGTCAATGCGAGAAGACGGGTAGGCGCCGATATAGTGGCTGGATG
GCGGCTGCGCTTCGAGAGCTCTTGCGTCGGGCAAGCTTCCACGGTGGGTGCGCGGCTCTTCGACTTCGATGCTGTATTCGGCAGCCTTTGCAGCGTGGTA
GTCAGTGTGCGCAGGCTCGTAGTTGGCGCGCAAAGTCGACTGCCGAAGTATTTTCGGAGACGGCAACGGGGATGGATTCGCTTCGTTGCCCTTGAACCGG
AAGCTTCGAGGAGGAGCAGGCGCATCAGTCACTTCGAAAATGTCGCCGTCGAAGTTGATGCTTTTCGGGGGCGCTTGGACTCGATCGATTTCCATTTCGC
GCTCGTCGTCAACGACAAACGTGCCGTTGCCGTTGTAACTCGGGATCGCTCTCTCACCGTCAACATCAAAGCTCATCACACTCATCGCACTCACCGGTAT
CCCCTTATTGTGCCCATTTTCGATGTCGGCGACGATGAAGCTATCTGGCGGGGCCACGCGCAGTGGCTCCTCGCGAAAAAAAAATTTGGACGGTGCTTTG
CTTTCCGTCAAGGTCGCATTGAGCCAGCGAGTACTCTTTCTCTCCATGAAGCTGGATGCAATGAAGCTTTCGTCTCGTCCACGCTCGCTTTTCACGATAC
GAAGGATGCGATTGGCGTTGCTGATCACGGTGCTGTCATTGCTCGTCTGCTTGCTCTCCACTAGGGTCTCCAAGAACTTCACCATCGCAGGGTAATAGGT
CAGTTCTCGCAGGAGAAAAGCTGGTTCTGTCTTGCTGGATCCATCCGCGGGCGGGGCGCTACGAACTTCAAGGATGCGGCGAACGAGCTTCAAGAGCGCT
GGGATGTCAGGATGCTGCATTGTGATTCGACAAATGAGCAGCTCCAAGAACTCACGGGAGACCATTTCTGGAAACTGCATCAGGCGACGAGCGAGGCGGA
GAACGCAGCGGTAAGGGAAGATTTGCACCATGTGCGAGTTGCAGTGACGCACGAGCTTCACGATCTGGTCCGGGATCTGGCTGTTCGCGATACTGTCATC
GATGTCCAGCGGAGCTCGCAGAATATACGTTATCGCGGTGGTCAGCCTATCCACTTCATCTGCGATCAGCTGGATACCCTCAGGCGGGCTTTGAAGATCC
AGCGTTATGAGATAATCCCACTTGGAACGCCACAGTTGGAATAGAAGCTCGAGGTTGTGTGCTGGATTTGTCAACGCTTCTGGGTCTGGTCGCGACAAAA
ACCGGTCGAGGTACAGTCCGGCAACAAAGTTGTTTGGATACTGGACGTAGTCAGTGTCATCATCGAGAATGACAGAGTCACGCTTCACGAGAGAGCGCTC
AATCCGATTTCTGCAAATGATCTCGTCTAGCTTCTTCCGAACTTCGGTTCTCCAATGCGAGTTCCAGATCAAGTCACTCTTCTCGTGGTTGTCGTCGAAA
AACTTGGGCGCTTTGGTGTAGTCCAGGTGGATCTGATAAACGACGGGGTACGGCAGGAATCGACAGAGTCCGCTGTACATCCGCTCTCGCAGAGAAAAAT
CCTTCTCGAACAGCGCGTAGAGAATCTCGAACGCCGGTCCTCGCAATGCCTCTGCGCGAAGGAAGTTCTCGTGTAGCACGTGTTGCTTTGATTGAAGCGC
CACGCCCAGAACTTCGACCCAAAGCCCGCTTCGCTCTACGTATTCCGCGATGCTGAGGCAAGTGTCACAGAGTTCCGCCAAGCATGACAGCGCGTAGAAC
GCCTGGTCATATCCAAGGTGGTCGGTGATGACTTGCAGACTCCACGTGAACTGACAGAATGGAACCAGCATCTTCTCCAAGCTGCACTCGAATCCGCAGA
TCTTGTTCAAGATGAGCAGCGCAAGTTCTTGACGTAGCAGGTACTCAGCGTTGCCAAACTCGCTTTCCATTCCGGACGGGAGGCCATCGGTGTTTCCTTT
CTTGTTGAACCCGTAAGTTGACAGCGACCGCCGCGATGAGATCGAAAAGCCCTTCTCTTCTGCGACCTTGTCAAACGGCAACAGATATCGACCCAGCGTC
GCAACGGAGATCGACGCGTTGACAGGATCAAAGTCGTCAACGTGTTGCTCCAAGCAGTCCGCAAAGGACAGCATGTACGCTCTAACGTCGGCCAGAATGT
TTAGGCACTCGAGAGCTGGCAGCGTGTCGGTGTACAAACCTAAGCTGGGGTCTCGATTCTCGTTCAGGAAGATGAAGATCGCCTCCAAAAAGTCTCTCGC
TGAAGCTGGGTCCAGATATTTCTCAATGGAGTTGGGATCCATGTTCGCTTTCTCGAGAAGAATGCTCAAGTAAATCCCACCGACGACAGGTTCGTCCTTC
AGGCAGTCGTACATGTAGTTCATCGAGCTCTCAAGGAACGACAGCTCGTCTCCGCTGCTGTCGGTACAGTATTCTTCGATGAGCTGCATGAGCTCCGAGC
GCATACTCGCATCCCAGATGCAAGTCGGTTCGCGGACTTCAGAGAGCAATATCTGGCAAAACTCTTCACCGGTCGGCCTCTCGAGGTAGTCTAAGAAGTC
GAGTGGCAGCAGATTCGCGAGCGCATCCAATGCTTTTGATCGACTGTCACCATTCAGCCCCAGGGAAATCGCTTTGATTGCGAGGAAAGCGCTGTCTAGT
GTTTCGCGCTCCTTCTTATGCTGGGTGATGCCTGTTTCGCCGTACCGATACGCGCTTGATCCCTCTCCAGATGTCAGCATGAGGTACAACCCTTTCCAGA
AGACACGAGTCGACTCGACAACTTGGTTCTGAAGCTCGCGCGATCGACAAAGAGCTGAAATGATCTCAAACGAGATCTTTTGCAGCTGCCACGGTTGAAT
GTTCTCAAACGACAGCATGAGCCGGTCGACCAGAATGTAAATGAATTCTGCGTGCCTCTGCTTGGTCGATTCCGTTTGAGAGTTGTACTCCGCGGCTGTG
AAGAACGTCGAAACGTCGTCTTCATCTTCTCCGGATGCAAACTCAAAACGACTTCCTGGTGGGGCTTGAGTAGCGCCTCCTCCGCTTTGCGAGAGCGATC
GAATACCTTCGTCAGATGCGAGAATCGCCAGCAAAATCGAAAAGATGTCTTGTTTCGCGTCAGCATTTCGCCCAACAGCATGATACTCAACCGCATCTAG
GAAAATTTCCCAGAAGTCTTCAACCGCCAGAAGCAGAGCGATGTTCTTCGGTGCGGATGCAACTAGTTCCAGAAGGATCTTTCTTGACTTCTCTTCAAAG
ACCAGCGACGAGCTTTGAGCGCGACTTCCGTCCGCGTTGATGGGCGGAGCAAGTAGCGACATCAGCAAGTCAAGGGCCTTGGACTCGAACGAGAAGAACT
GGAACTTGAATTTCTCCAGAAGGATCAGCTGAGCTTTCAGGATGCAGTCGATCACTTCGTCTGCTGTTCGTCCGAGATCCATTTCATCTTTGCGTCCAAG
TCGGCTGCTCAACGTGTCAAACGCGCTGCGGACGGTTGTCACCTCAACTCCTCTCGTGCACAGATCTCGATACCTTTCGCGAAGGTCTGTCAGCGTGTAC
AGCATGTCCTCATTCCATCCGAAAACCTTGAAGGCTCCGGTATCATCCAGGGAATCCAGTCCTCTTGCTTGTCGCCGAGTCAAGTAGCGCCACTTTTCCT
CAATGCTGCTCATCAATATCAGCGGCTGTTCGATCGCATTGACTTCGACTTCAGACTCGACAAGCGTTGACAGGTAGTAGCCACTGCAGAACACGTCATG
CGAGAGTTCGACGTAACTGACTGGAGGGATGGGAATGTAATTGTACGTTGCTCCGACATCGCGCTCCAGATCCTCTTTGAAGTCTTCAATGTGCTCTTGG
ACCATTTTCTGCAGGTGGCTTCGCATCGCCGAAGACCACAACACCCTTTTATCAGCTTTCCGGCATGTGAAGATTTCAGCAAACGCTTCGGGAGAATCCG
TGTCGAGACTCGTAATCAACGACTCTGGAAGTAAATCCAGAAGATAACTCTGGCCGAGGTATCGCTCTTCCGACTTCTGCATTCGGTGAATTTTCTTCAG
CAATTTGGCTTCAGGGACGAAAGTTGCGTCGTCGCTGTTTCTTGCAGTTGTATCCGCAGCGAAGAGGAAGAAGAATGCCCCACATGAGTACAGCTTCTCG
AGAACGGTGTCGCTGAAAGACAGCAGGATCTCGCACACCAGCTTGTGAACAACCTCGTTGTCGATGAGCAAGAGTTGTGCGAGCATCGCCACAGACGAAG
GCTCAGACAGAATGCTGTTAGTCAGCGGCAACGGCCACACATCTGCAGAAGTCGACGACGCAATTTGCTCGTTGAAAATGAAGTTTCGCAGAATTCCCAA
GGCGTACGTTGTCGTCTCGTGAAGATCTATCGACTCGTCGGGCAATTCCATCCACCGTAGCTCTGGAAATTCAGCAAGAAACTTCCAGCTGTGAGCGTCT
TCGTCGGCCCCGGCATGCTTGGAGCAACAGCACACGTACACGCCAAAACTGTGCTGGCGCCTGCTTGCTGAATCATTCTCCAGGAATTCCTTCAGCTCGA
CGACTGTAAATGGGCCGTCAATCTTGATGCCATTGTCAGATTCCGTAGCGATGTGCTTCGCGCTCCACCTCAAGCTGAAGCGCGAGTTGCCAGCAAACGA
CATCCCTGCAATGTGCAGCGAAGAAGCTGGATCAGACTGGACCTCCATCAACGGGATGTCATCGTCGTCTTCAGCACCATTGGTATTTCCGGAAGTCTGT
TGCTTCTCATCTTGGAGTTTCCGTCGATGACCAAGCAAAGCGAGATTTAGAAAAATCTGAATACTCCTCTTCGAGCAGAATTGCTCCGTCGCACCGTTCG
CGAAGCTCATCTGGAACATCAGCTCCACGATGTCTTGGATTTCACCAGCGACGAAAGAGTTGTTCAGCACTTGGATCAGGAACCTGGCGCGATTGGGTGT
GATGTCCCTGACGCTTGGAAATACTCGTGCGATCTCAATCAAAATCTTCAACATCCAGTAGCAGCTTTCGTCAGACTCGTTACTCTTTGATAAGAAGAGA
GACTCGCTGCCTGGCATTCCACCGGCTCCGGACTGAACAAATCTGCCGAGGTGCAGATTTTCGAGCCAGCACTGGTACACCTCGTTGAAAAAAAGCAGCG
GCGACTTCGCAATCTCTGCACTTGCGTGGAACAAATCAGCTGAACCGCTCGAAAGCGGACTTTTCGGCCGAGCTTGCTGACCGTTTGTAGAATCTAATCC
GTTCGCGACCTGGTCCAACTGGAGTGAGCCATTCTTGATCTTCTCATGGAGTACTCGGAGATAAAACCGTCCGGCTTGAGGCTCCTTGCTGAGACATTCA
TAGTCGACGCGAAATTGTTTGTGGTTCCACTTCGGCTCAGTAGCTGCTTTTCGCGATGATCCGATCGACTCAAGTGCGCTCGAAGGAAGCGGCACAGTCT
GCTTCCAGGATTCAAAGTCTTTAAGCGCTTCTTCTAGAGCAACCTTGAGCTCCTTTCGAGCTTGAGCATTCCAGATCAAATCCGGGAGCACAAAGTCCTT
CTGGAGTAGCTCTGCGAGAAGTCCAAGATCCGACGCTGATTCTCCCGAGTAGTTCATTCTGCTGTTGTCTTCTTTTACTTTCACGTGGCTCCCGTTGCTC
TCTGGCACGCTTGAGAGCACTTGTTGCTGCATCCGCTTGATGAACCAAGCCGAGGCGCTGGCGTGGGCTTCATCTTTTTTAGCCTTGAGGTGATTCTTCG
CATCCACTTTGTGCTTCCGTTCACGCTCTTTCTGGATCTTCTTTCTTGTCGCGACGTGCGAAATCATTCGAAGGAAGCCATTTGGCAAAATGCGCAGCAG
CATCTCGTACGACGACTTGTGATGCGCAATCCATATTGCTCCGATGAACTGGTAAACTTCACGTCCGTCTTGCCTTGGATAGAAGAATGCTTTGTGGAGA
TCACTTAGCGTTTGGCCACTCTCCAGAGCTGCGTCGCAGATGCGCTGTCGGACTTTCGCATCGCCATGATCGACAACGAGCTTCAGAATGGAAACCGCAG
CAACCTTTAAGCCACTGTTCTCGTTTTGCCTCGCAAGCTCCATGAGCCGGGAATGCTGGGAGCTCAAAGCCTTGATGATTGCATCGAAGTGGTTGTTGTC
GGTACTCAGGCGAGTCGTCGTCAGAACTTCAAGGAAGAGTTGAAGCACCGCAATGGTGCAATTTGCCTTCTGCGGGTTCAGAATGTCCACGAGCTGCTGA
AACAATTTCTTCTGCTCGAACACGAGATGGCGATTGCTCTTTTCAGCGAACTTGTTGGCTGACAGTCGTGATCGATCCGCAATGAGCGAATGCAAAGCAT
TGACTGCCCAAAGCGTTGATGTAGTTTCACCCGCCGCCGCAAGCTTAACCAAGATCCCAGCGATTTTTGACACCTCCGTGTGCTCGTCGGACACCATCTT
GTAGCAGCCGTCGGTTATACGGCAAAACGCATCCAGGATGATCGAAACCTCGTTCACTCGCACAGGTGGTTTGCTGGACTGCTCAAGCTGAAGTAAAACA
CGTAGATATTAGTTAGTATTTTCAGTGTGAATGAAGGAACACACAATCAAGCAAGGTACTTACCAAAATTGAAATTCCACGCAGTATCGATCCAAACGAG
AGCTGCGAGAGTCGAGTTTGAAAAGTCTTCCCGGAAAAATCGTCTGCGCGAGCGTTCATGTTCATGTTTTCGAAAGCGAACATGACCTTGTCCGTGGCTG
AAGTCGCTGCTAATCCTTCGTCTTTCGCTTTCTCGATCTCCTTGGAGAGCTCAGCATGGAACGGAACATAGAGGCCTTCGTGGTTCAAGTAGAAGTATCG
CTCCAGCTCATCTGTCAGCAGCGCTCTTGGAGTCATCCGCGGGTTGATTTTCGAGAACTCGGAGCCAAACGAGACGCCCCAGTTGTTTACAAAACGATAT
CCATCGTACAAAACTCCCAGGAATGCGTCGAGATCAGCTGGGATGTAAACCAGTCGAGAGCCATCGCTGAATTCCAGCGCAACCACTGCCTCGTTGTTTT
CTCTGTCGGCGCGTGGCGTCACAACCCGACGAAGCGCTCGGAGTGAGTACAGCTTGTTCGAAGTGCTGTCAACCTCCCGGATGCTCCCGTCGATGACGCA
AATTTTCTTCCTCCGATGTCTGGTAGATCCGTGCCTTCCTGTTCGCTTCTGAACATCGAGCCAGCTGAACGAATCGAGGCTATCCTGGTCAATCAGCACT
TTGATCTGCTGCTTCGGGAGCTGGTCAACGGTTGACGATCGCAAACGGATGCCAATCGCGCCAGCAAGATTTTTCAGTTTCTGCACGATCACTTTCGCCT
GGTCGGAGTACAGGTACTTGAGTTTCTTGGCGACAGTCAGAACCAGCGCATCTGGGTCACTGGTAGCCTGCACGATTTCTTCAATAGACCTGAACTCGAA
CTCGTGGGTCTCGCGATTCATCACACGGACGATGATCAACGCTCTTGGAGTCAGGTAGACGTCGCACTTCTCTCGCTGTCCATTTGACGTGCTGAAAATC
CCACTGAACTGGTAGCACTCCATGCTATACACGCGCTTGAACTCTTCAAAACTTCCGATCATATGGCTCATGAGCTCTTGTAAGAAGACATTGCGACAGC
GGTATCGAAGTCTCAAGAAGATTGGCTCGTTGTACTGATCCAGTCTCTTCTTCAATGAACCGCACGATGATTCGACGAACAGTCGATATTGACGCAGCAG
CACCTCCGGATTCTGGACCGCAGCGCCACCACCAGCTGTACTCCCACTCGATGAGACGGAGGACAAGCTGGTTCTTCGAATCGAGTTGTAGCTGTTTCGT
CGGGACAAAATACCTGTTTGCCGACCGGAGAGCACATTGGTACCGCGATTGCTTGTGACGCCGTAGTTCGTAGTCTCGCCGAAAGTCAGAGAGTGATGTG
GGACTTGTCGAGTCCGAGAGCTGCCCAGCTGACTGCCTCCAAACTGAGCGAAGTATGGGTTGTTTGTCATCCGGCTAAGAAGACCAACGCACGACTCGAC
GGTGAGCAGACTTGGAAAGCCGAACAGGATCCGTTGCACCATTCTGTACTTTGTCGCGAGGTTTTGGTAAAAACTCAGCGTGAGTTTTTCGTGCTTGGTG
ACGTCGGTCTTCACCAACATCAAGACTAGGCGGCACAGCATCATCGTTGGCAGTTCGGATAGGTACTTCTGACTCTGCTCAAAGCAAGAAAAGGTGTCAA
TTACATTGAGTGTTCAATAGAGTGCAGTGTAAAACGTGACATCCTTACCGTGGTGTCTTCATCAAAGAGTGACAGGAGCTTATGCTGGAAAGAGCTGCTC
GATAGCAGAATTTCGCGGCATTGGACTCGGTTGGATTTTGACTCCAGCAGCCGGTGTAACACCAACAGCATCCAGTAAACTGAGACCGGTACTCGGCAGG
TCAGAATCTGAGTAATGGTTCCCATGTATTCTTCTCCGCGCTGCACAACGCAAACGTGCCACACAACTATCAGTTAGTCACATTCCGGCAAGATAACAGA
ATGCCAAGAGAATGTCAGACTTACCTCCACGAGGATCCTCACAAACGCGCTCATCGCTGGAGGTGCTTGAACCAAACGATACAGCGTTTGTAGGTAGGTG
GGGATAAATCCGTGTCCGGGGCCGTGGCGCAGCACGATGTCGTGGATCTCTCGCGCGACAACCCACGTCGCCTTCTCAAATGGCTTGTTGGGCTGGGCGA
TAATACCAGGCGTCGGGGTGTTCACGTTCAGTTCCAGTGCCAAGGCGTGCATTTCTTCGTCGAGCCCTTTCGGTAACTGGCGCTGGACTCGAACCGTTTT
CCCGTATCCGTAGCTTGCAAGAAGCGTCAGGATGCTCGATTGAACGACGCGGAGTTCGCGGTCCATGACGTTCGTCTCTTTTCCAGCATTGACGAGGTTT
CCACCTTCGTGCTGGATAATCTTTCGCGGGAGCATGCGCATCCATTCGGGGTAGAAGGTTGTCACCACATCGACCTGGTGATTTCCCAGTGCATGGCACG
ACGCCAGCAACTCGCACACAATCTTCTCGTTATGTTCGCTGCTGTAGGTGCGTCGAATTCCGTCCACGTACTCCACTTGAAAAGCTTGGGGCGTATCGCG
AAACAGGATAATACTGTAAATGCGAGAGAGTGGTCGACTCGAAACCACCGTTTCCGCATCCACAGACTCGGTGATGTACTTCTCGGACACTGAGAGCAAT
CGTGGCGTCGCCTTGGTCGGCGATTGCGAGATCTTCTGCACTTGGTACTGAAATGACGTCCCCTCAGCCAACGACGTTCCAGTTTCATCCTTACATGCAG
CCTCCATCGTTTTCTTCCGGTATTCGTTGATCTGCATGCCGTACGATCGCATCACGCGCTGGATGGCCAGCGCCAGCTCGGTGCGCTTTGGAACGATGAA
CAGGCTCGAGTTGTCCGAGTGATTCAGACTGATCGCAGCATGATCGTCACAGATCACATCGATGGAGACCAGGCTCGTGTACGGGATGTGGGACATCAGC
TCGCCGTCGCGGTCTTTCTGGTAGATACCATCCGGTCGCACTTCAATGACGCATGGGGACTGTACTCCTCGCTTATGGTACTTGAAGCTCTGGAACACGT
GCGTTTGCAGCTCGGGGCGGGCGACCTGTCCTGGCGATCTCGACTCGTGCAAACTGCGCAGTCGCATGAGGCACACGAGCACTTCCATGCGGAAGTGGCA
GCGATACACCGTCTTCTTGACGCGGTGACGTGGCGTGTAGATGATAAAATCCTGTACAGTCACATAGGTATTGAAATCGAGTGCGTTAGTCGAGCAAGCT
GGAGTGAATCATACGACAGCATCATGAGCAGCCATGCGCATGAAACGTACCGATTCGCCATCGACAATGCTCGCAGTGTCAACATCTTCGTATCGCCACG
TGTTCGTGGGCAGCTTGTTGTCCAGGTCGTAGGTCCAAAAGCCCTTGTCGCCGAAGCAGAGCACGCGCTCCTTGACGACAAAGCTGCCGACCTTATGCAC
CATGAACCGCGCGAGGATGCGCTTCGTGTCAACTGT