Description :
From Genome Similarity Track
Location :
Scaffold_16:75707- 76839
Transcript NameFunction/comments
Phypa_INRA-310PPTG_08710hypothetical protein

Sequence
1132 bases(100 bases per row)
CTTCTCGCTTCGCCCGAAGAGCTCATCGACACTGCAAACACGCACCACGAATCTCCGCCGGCGTGATCTTCTGCTGGACAACGTCGTAACGCGCAGCAGC
ATCTCGTTTGTGCTTAGCGATGCTGACCCCGATCTTGTCCACGTGCGTGCTGTCGCCCCCAATCGGCAGTTCGTCCCGGAGAGCAACACCTCACGCGAAG
ATGTCGCCATTACCGCCCAGTTTGGCGTTCACTATTCGCGGATGGAGATCGAAGGCCAACCGAGCAGTGGCTGGCCTGTAAACCTCAGTCGCGGAGCGTA
GTTGACGAGGCTAGAGATGAAATCCTGATCAATAGGAAACGCCACACTAAATGGGGTCGTCCGCAAAAGGTCGAGTCTGCGTTGGAGCGTATGTAAAACA
TCCCCGTATCCGGTAGGTTCAATAAGCCTCGCTACTAAGAGTTGCCTTTTGTATTGCATTCCGATGAATATAACTACACAAACACTGGGCCAAACACAAA
ACAACAACGGTATCAGAATCAATAGTAATGTATATGAGCACCAAAATATCCGTTCCATCACTATAGAAGGTCTTGTAGCCGCCGTTGCCCTTTGCATTGC
CTTCAACAAGCTTCTGCACCTGCCATCCATCCCCGCAGGCGTATTGACCTAACGTACGCTCTCGCTGTGACGCTTCCAACGTTGTCGAAGTCGCTTATAC
CACTCTATTGTGACTGGAGCAGCATACGTGACGCCCTGCCGGGTTGATGCTGACCAACACGGGTGACACGAGCCGCGAATTCAACTGGAAGCCCTGGAGA
AACGTCTTGAGCAGCCTACCGGCACGCGTGGGGGTTTGGGGGCTGTCTCTGCAGGCTCTGTCCAGGCCGAGGGTCTTTCGCTAGGCTTCTCGCCATCCCC
TTGCTCCTTCGGTTCTTTGATTGTGGCGCACTGCTCCCTTTACAGTGTGTGGGACACACCATGGTCATTGATTGGCTGCTAAAAATTGAGATGCTTGTCT
CACTGTTGCTGCACTGTTGCTGTAATCGGATTTTGCTGTGTTTAGGATATTTTGTCATTTTACTGAAGATTTTTCAAAGGTGTTTTAAAAAGCAGCATCT
TAATTTCGTCCTACGAGGTGCGATAAAATTAG