Description :
From Genome Similarity Track
Location :
Scaffold_183:757- 6484
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_183-fgenesh-gene-0.2Serine palmitoyltransferase
Pytar_ATCC12531maker-par_contig_183-snap-gene-0.6Conserved gene of unknown function
Pytar_ATCC12531snap_masked-par_contig_183-abinit-gene-0.23Calmodulin-binding WW domain protein

Sequence
5727 bases(100 bases per row)
GATAATGTTCAATGCCGTGAGGATCTGCTGGGCGATAACTGGCGAGAGACTCGTGGCGTAGTTGGCGCCGGCACTCGAGCTACGCACAAACGCGACGAGC
TCTTCTGAGGCGGCGATGTAGCCACCCATGGCGCCGAAGCTCTTGGTGAATGTACCCATGAGAATGTCAATCTCGCTCGGGTCCACGCCCGCGTACTCAC
AGATACCACGACCCGTCTTGCCCAGTGCGCCAATGCTGTGGGCCTCGTCCACGTACGTGTACGCCTTGTAGCGCTTCGCGACGTCCACGATCGCGCGCAG
ATCGACGATCTCCCCCTCCATCGAGTAGATGCCTTCGACCATGACCATGATCTTCTTCCACGGACGGTGCGTGCGCGGCTGGCCCTCCGCAATCTTGTTG
CGCAGCACCGTCTCGAGATGCTGGGCGTCGTTGTGGCGGAAGACAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACCAG
ACGAGCGTGCACCGTTGACGATTGAACTGTGGTTCATGCTGTCACTGATGATGAGCGTGCCCTTGCCCATGAGCGCCGGGATCGACGTCGAGTTGGTCGC
GTAGCCCATGTTGTACACGATCGCAGCGGGTTTGCCGACAAACTTCGCGACCGCGCTCTCGAGTTCCTGGTGAATGGCGCTCGTGCCAAACTCCATGGAC
GGCGTCGTCGCGGCCAGGCCATACTGGTGAACGGCCTTGAACACGTCCTTGCTGCACGTGTTCATCCAGTCATCGGCAAAGCCGAGGTAGTTGTACGAGC
CGAGGTTCGTGCAGTGGCGAACCGAGCCTTCCTTGCGGTGGAGCGTCTTGTTGCCGTCGACCGAGTAGCGCTCAATGACGTCAATGTGGGCACCAGGGCA
GCCGGCGACCGGGCGGTTGAACACATCCTGCACGCGGTGGTAGATGCGGTTGGTGTAGAAGTTCTCCCACGCGATCAGCAGGCGCGCGTAGCCGCTCTGC
GTCATCTCGGACGCATAGCGCGAGCCGAAGATGCGGCCGAGGTAGTCACGGATGTGGCCAAACGTGATGAGCGTGGCGAGCTGCACGTAGCAGAGAATGA
CCGTGATATACGGCACCTTGTCGCCGGCGTGGACCTTCATATCCGGCATGGTTCAGTCGCAGGGGTCGCGACTTCTCGGACGTGGCGTAAATAGCGAACT
GGAGCGGAAGGGCTCCGAAGCGAAGGAAGGGATTACGCTCTCGTCCGGGACTCTTGGTCGGATCTCGAGACACAATGGAGATGGGGCCGTGTGTGGTGCG
GAATCCTTCATGGACCGCCAGAGAGCTATAAAACCTCAGCGATTACGGCGAGCGGCACGTAAATAACCTTGAAAAAGGTGAGGTTTTGAGGTGCAATAGG
GCTTCCTGATGACGGAACCAGCGCGCTTGTCGCCGACAACACCCGCGGATCTGCAGATGTCGCAGAAGTGGGCCATGCAACAGAAGCCATGCACATGGGG
TGTGGCCCCGACGGAAGCGAACATGAGCCTGTGGGGCGGGACGCTATGCGCTCGCGGCGCATAGGTATTAATATTGCCGCGGACGTGGGTTCAGGATGGG
GCGTATCGCCGACCTGGACTGTACCGTGATGTGGGCCGACCAGTGAGACGGCGCAGTCCACAAGTCGCAGGTGGCGTCAGACTCAGACTCAGATCCGGTC
TCAGATTCCGCGGAAACCTTTCGCGCATGAAGCGATCGCGATCGGCTCTCGCGCGCCACCGCCAGCGCAAGCTGCAGGAGGCGACGCTCCATGTGTCGGA
CGTCTCGGACCTCAGCGCCGTCGCGGCGATCGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCTCCACGAAGATGGCAACGAAG
ACGCCTCGTCGGCGGAGGAGGAGGACGAAGCAGCCGTTTACCAGGCGATGCGCGTGCTGCGCAATGTCAAGAACAGCGTGTACCACCGCGCGATGGCGGC
GCGTGCGCTGGGGTTGCTCATGCTTCAGACGCCGCCGCTCGTGGCGCGGCTCGGGCTGGAGCGCGAGGACCTGCTCGACGCGCTGCTGCAGCTCGTCAAC
TACTGCCGCCGCCTCGACACGCGCAGTGCCGACACGCGGCGCGTGCACGTCAACTGCTGCGTCGTGATCTCCATGCTCATGCGCGCGGCGCAGACGTCAC
ACGAGTCACCGNNNNNNNNNNNNNNNNNNNNNNNNNTGGTCGCACTCGACTCGGAGTTGCTCGCCATGCCGCCGCGGCCGACCGAGAAAAGTCTCCTGCT
GACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCATCCGTCGCGCCC
CGGGAGAGCCCGCGGCTGCCGCTTCAACCAATTGTACCCCTTCGACCCCAACGATTTCCATCGCCCGTCCCGCAGCACAAGGCCAGCCATGGTCTACCCA
TGCAAACGAAGGCGACAGCGCCCATCGGAAAAGCAGGCCAACCTTCCTCTCTCCCTCGCGAAGAAGACGTGGCACTCGCACCGGCCATCAAGCGGCAGCA
AACGCCCAGCCGCCAGTTCAAGATGGATCGCTTCCGCGTGATCACGCCGGCGCTTGTACCGTCGCCATCATCCAGTAGTACACCGCTGCTGCGCAGGCCC
CTTCCTGTGATTCCGCCTTCGCGGCATCAGATGAGAGAGCCGTCCTCGTCACTGATGACAGGCAACGCCAACCAGCGGGAGGGTTCCCAATGTGATGAAC
ACTCCGAAGCGCCTGCGTCTCCTTCGCTGTCCTCCCCACCACTCCCTCGCTCCTCGTCCACTCTCCTCCAGCCCCATCACATGGTCGAGATCCTGCGGTC
AGGACGCATGCCCGTGGCCTCGGCCGGCTACTTCCACACGCATTTGCGTGACAGCTCCGTGTCGCGGCGAGCCTCCACGCCCAGTCGACTCCAGGTCGTC
GAGTGGGGCGAGTGGCGGCGGCGAGAAGAGAGCGGTGGTGGTGAGAGCAGTGGAGCCACGGAGCGAGTTGAAAAGCCGGTCCCGTCATCTCCGCCCATCA
AATCGAGTACCGTGTCGTCATCGTCCCCGATCGAGAACATTCACACGCCCGAGTACAAGCGCGCACGACTGCGCGACATTCTGTCGTCGCCCATTGAGCC
GTTCCCCCGCAACACGGTGCAGCTGCTTGCGCTCGACAACCGCCACAGCACTACCACGATGCGCGCGCTGGACGAAGAGCTCCGCGAACTGCGAGAAGGC
GACGCTCGCACGCGCCAGCAGATGCGTTCGCAGATCGAACGGGAGCGTGACAAGCTGCCGCTGAAATTCCTCTTCCAGCTGCCAGGTGGGGCCGCGTACT
GTCGCGACCGCATGCGCCGCGCCATGCAACTCTGGGTCCTGGAGTTTGAAGCCAACCAGAAGCGCATGGCCCTGCTCCAGTGGAAAGCCGTCGTCGAGCA
GTGGCGCTTTCGGCAGCGCGGCGCGGCGTACCATCGCCTGGCGATCGAGAAGAGACTGAAGGTCGCGATTGAATATGTGCTGCGCGGCTTCCAGCAGCAG
GCACTGCGGAAGTGGGTGGAGACCGTGCAGCTCGCGATTTGGGCGGACCGGGATACAGCCGTCCGCACAATCCAGCGCCAGGTGCGTCGTCGCTTTGGGC
TGCTTCGATTTCTCGCGTGGCACGACGCGTACCCCGTCGGTGGACCGTTCCTGCGAGACGTCTACCTACCGTCACCTCGAAATGCCTACTATCAAATCCC
AACGCGTGTCCGGCTGGAGCGACGTCGCCTCTGGTTTGCCGCCGAGCTCGTCCAGGGTGTCTACCGCAAGCGGCGCTTCCGCAAATTCCTGCAGCGCTAT
CGTACGGCAGCCGTCATAATCCAGGCTCGCGCGCGCATGCGTATCCAGCGAACGCTCTATCGGCTCACGAGAGATCGCATCATTTGCCTCCAGGCTCATG
TGCGAATGCACCACGACTTCCGCACGTACCAGACACTACGCCGCGCGGCCGTGCTCGTGCAGATCAATTTCCGGTCCATGCGTATTAAACGGCTACGCCA
GCTCGTGATCCAGACGCAGCGGCGGGAAGCGGAGCACCGGGTCACGGCAGCGCTACGCCTGCAGCGCGTCGCGCGTGGTTTCTTGGGCCGTCGCGCCGCG
AGACGTCGACGCCGTGAGTGCGATGAGCGGTTCCACGCGGCGTTGGTTGTGCAACGAGCGTGGTACCGGCGCAACAACGAGTGGTCGACGTTTCTATTGC
TCGGCTGTTTGCGGGAGAAAGAGATGGAGGAAACCCACTTCGACCGAAAAGTACTGGCCTTCAAGCGTGGCTACATGGCCAAGCAAATCCAGCACACGTG
GCAGCGGCACCGTCACGGCAACAGAACGAGCGCCGCCGGCGTCGTGGAGCGCAACGTACGTCGGTGGATNNNNNNNNNNACGGCACCGCCACGGCAAGAG
AACGAGCGCCGCAGGCGTCGTGCAGCGCAACGTACGTCGGTGGATTGCCACACGCTTGGTCAAGCGCATGCGCTTGGAGCTGCTGGGCCATCGCCGGATC
AAGTGGTTTCTCCGCTTTGCTCACGCGCACCGCGTCGCGACGGCCCGAAAGCTCCAGTTCTGGTGGCTTCGTCGTGTCCCTGGCCGACTCGCGGCCCATT
TGCACCTGCGATGGCTCGCGTACGAAGCTAGCAGACGGCAAGAGAAGTATCACCGCGACGAGCAAGCAGCGACACGAATTCAGAGTCTTGTCCGCGGGCG
ACGCGATCGCATGCTCGCGCGAAAGGAGCGATCTGCACGCGTCCTTCAAAAGGCGGTGAGAGAGTTTCTCATGTGGCGCCGCGTGAAGCGGGAACTCGCC
CGCCTCAAAGCCGATCTCGCTCTCCAGCAAACGCAGCAATGGGTCCGAATCGCCTTTGAACGCGTGTTCGCAGTCAAGATGGCACGACTCAACACGGCGG
CGACCCACGTCCAGCGGTTCACGCGAGGCTTCTTGTGGCGCGTCCGCCTCGTGCGGCTCTTGGTCGAGACCGAGTTGCGCGACCGCATGGCCAGGCGTAT
CCAGTCCCGATGGAAGCAGAACGCCCAGTCGCGGCTCGCCAAGCGCGTGATCTCTGCGCAGCGCCGACGGCGTGAAAACCCGTTCCGCGATTGCAACTCC
GTAACCCGTGTACTGCACGAAATGCTCGGGCGCGCAAGTGAGCTCTTTGATCNNNNNNNNNNATAACTCGTGTGCTGCACGAAATGCGCGGTCGCGCAAG
TGAGCTCTTTGATCCAGACGACGAGCTCCGAGGTCTCCACGTGGCCACTTGGCTCCGACGTCTCGGCCTGAACGAAGAGCTCTACTACCCGCTGTTTCAG
AAGCTCTCGAATGCTGGGAACGGCTCGGTCTCTGCACTCCGTGTGTGCGGAGGACCTGAAGAGTGTATGAGACTGCTCGAGCGGATCGGGGTCGTCGACG
ATGACGACGCGCACCGCATGGCCACCAATGTGTTTGCGGCCCAGACGCTGCGCGAAGTTCGAACGAAGAGGTCTCAGGTCGAGACCCTCAGTCGCGTCCA
GCGAGACGAGGAAAAGCGCGTGGCGTTTGCGCAGCAGCAACTGGACCATGCAAAGCTCTCCAAACAAGAGGCAGNNNNNNNNNNCCGAAATGAGGAAAAG
CGCGTTGCGTTTGCGCAACAGCAGCTG