Description :
From Genome Similarity Track
Location :
Scaffold_1685:757- 3142
Transcript NameFunction/comments
Phyag_g11260hypothetical protein

Sequence
2385 bases(100 bases per row)
TACATTATCCCTCCTATTTCTGTTTGAACAATTAAGACAGGATCAGCACATGGATGGCACCGGAGGAGTTCTCCGGTGCCGACAAGTAAATCAATGCACT
ACAACTCAATTTGCTTCTCAAGTCTCAAGTCCACATTCAAcaggttatgagcccaagGCAAGCCGCCCCTGACGACGACCGCGAGTTTCCGCGCCTCAAC
GGCCGGAACTTCATCATCTGGAAGACACGCGTCACCGCTGCGCTCGAAGGCAAGAACCTACTCGGCTTCGTCACTCACCCGGACTACACTGGTGACTCTG
ACCCAgacttcagcgacgacaacgaaCTCGACCCCGCGCTCTTCAATCAGAACCAagcggtgaagaagacccTTGACGAGATTGGTGCGCCCAACGCAGA
CCCTCCGGCTGACACCTCACAGAGCGCAACCTCCGATGcaagctccaccgcctcaGACGCTGGCAGAGACGTCGGGATGACGCAGGAGAATCTCCCTGCG
GTCAAGACGTTCACTGCCACGAAGCAGGACGAACGCAAGCGAgctgagaagctgaaggccaAGAGCCCCAAGCTGAGCTCGAGACAGCTACGCCACATGG
AGGTAAAAGCAAAGGCCTTCTTGATCAAGACCATCGATGACAATCATGTTCTCATGGTCAAAGACAAGACCACGGCATACGAGATCTACAAGACTCTCTG
TACCATGTACGAAGATGCCATCATTCATGGCGATCCGCACTACATCCTGAACTACCTGGTGGCTCTGAAGTATGAGGAAAACTCGGATCTCAACAAGTTC
CTGTACGACCTCGAAGAAGCCATGAAGGCTGCCTCAGACGCTATAAACAGCGTGATGGGAGATGAGCAAAAGACCATCTACCTGTACCATTCACTGCCTG
AGGCCTGGAAGGCTGAAATGACGTCATGGAAGGGCAATCGCAAGTACGTCCCGTATaaggagctcaagcaccACATCGAGACCAAGGCCCGCAACGAAAT
GGCGCGCAATCACTATATTCTCAAACAAGGTACGCCGGAATCGTGCGAAACCAGATCCGAGAAGGCGCTACAAACTGCGGACCCTACGCCCACGCCGGAA
CCAGCAAAAGAGGCTACGGCACTCGTGTCAACCCCGAGCTGCACGTACCGCCTTCGTAACAACCACGACAGTCAACTGTTATATCCTACAGCGGCACCTC
CTAAATGGCCATGTGAAAGCTGGTACAGTCATCCCAGCCAATTTCAAGGTGAAAGTGGATCATGGCTCACAACGCCAGCACCCTTACAAGCACGAAAACA
AGGGCGACCGTAACAATAACCACCACATTAACTACAACGGACGCGGAAACAATTCCCGGAACTCCAAAGGCAGACGCGAAGACCGTAGTAGACGCAATGA
CTATCAAGGCCGCAATAACCGCAACAAATTCCAAGGATGTCGCAACCAAGGCGGGGGAAACTCGTCCGACAACAGTGAGTATGGCATTATTGCCATCATG
ACACTCAATCTTGCTGAAGAAAACGAGAAAGTAAGCCTCACTGCCCAAGACGTGAACCACGACCCGACTTGTACTATCGATTCTGGCTGCACTCGTCACG
TGACGTCGAGACCCAATTGGTTCGAGAACTTGCAGCCAACAACAGGCAAGTCCATCACGGTTGGTGGAAACCACCAGATCCCCATCGTTGGAACCGGTGA
CGTGAAGTTGAAAATCGAGGACAACAAGGGAAATGACCGCATCATTACGCtgaacaacgtgctgtaCACGCCAGAACTCAAGTTTAACCCTCTCTCGGTT
CACCAGGCTGTTGAAGACGACTACAAGCTCAAATTCCCCAAAGCCAAGAAGTGCGTGCTATTCTTCGCTCACAGAATCAAGTTCGAAGCCAGGACTGGAG
AAGGCTCTCGCCTCTACCAGTTCCAGGCTCGCCCAGCGGACACCTGTCAAGCAGCCCATGTGGCCCACTCAGGTACGTCCGATAACATCATACTTTGGCA
CAAACGAATGGGTCATCCTAACTTTCGCATTATGCAGGATCTGGCGAAAACTGAACTCGTGAAAGACATGGGATTGTCGAAATTCGACCCTAAGCAAGAC
TACATCTGTTCTTCATGCACATACGCTAAGTCCCATCGTAACCCATTCAATAAACGCACAGTTGAAAGGGCCAAATTTCCCCTTGGAAACATTCACACAG
ATATGGCAGGACCATTGCCAGCACAAACTCTGTCCGGATATCAGTACTTCCTGACATTCATCGACGACTACTCACGATATATGTTCATTTACATGATCAA
AAGAAAATCCGATCTGTATGATTGTTACGAAGACTTTTGCAAAAAGGCCCAAAACATATTTAGGGCAGACGTTAGCCAACTACAC