Description :
From Genome Similarity Track
Location :
Scaffold_3183:757- 2627
Sequence
1870 bases(100 bases per row)
CCTACTGGAGGCGTGTACGAAGTGGAATATCGCTATCAGCGTGGTGAAGAGTTATTGGGGGATGCGCAAGGTGAATTACTTAGGTCATCGAGTCTCCAAG
GAGGTATTGGAGGCGAATCCTAAAGACATGTCTTCGTTGGCAGACTTGGCTTTCCCACAGTCGCTCCGGGCGATGCAATCCTTCTTGGGCAGCTCGAACT
AATACAGTCGGTTCATTGAGGATTATGCACTTTCGCCGCGATCCTCTATGAATTGAGGGAGGTGGATTTTGCTGCGATGGCCACTTCGGCTGTCCGGATC
AAGATTCAACAAGCTCTGGTCCTAGCGATCCCAGATCCACGAGGGGACTCACGTAGTACGACGCCGGAAGACTACCTAAAACAGGAGCTGGATCCATCCC
GGGACCAACGGGGAGAGGGTCCAATCTGGAGGAAGCTGACGGAGGGGAGCTCGAAAAAGGTGGGGCCTCGGTGGATTCGAGCTCAGCACGCGTTCGTGGG
GTTAAGGAACAGGATCGCGTCGACGCCCATCCTTCGCCATTTGGATCCGGAGCGTCAACCTACGGTGATAGTTTATGACAGTGACTGGGCAGTCTCAGCA
GCTTTGGTACAAGAACATGAGGGGATCTGCCATCCGGGCACCTTCGTCAGCCGAACGCTAAAGCCCAACAAATTGAATTACGGAGAGGTGGAGAAGGAAA
TACTCGCACTCCCGCGGGTGTTGGATCTCAATTAGAACCTGCTGGTGGGAAGATCCATCCGGCTTTTGACTCGACATTCCACGCTCGCCTGGCTATTTAA
GTCAGCCGGTCTGCAATGACGGTTGGGACAATGGGCAGCCCTACTTTCACCATGGACACTGGAGATCGTTAAATGTTCGAAAGGAGAAAACTAGATACTA
GGCGTTTTGGCCGCGAGCAACACCCCCAGAGTCAAGATGGACGAAGCACTGACTAGGATCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCAGA
TCCCGACGGTACAAGAAAATGAGAATTTGCACGCCCTGAGTTTCGATGGATCTGCTCGCGTACGATGTGGTGGAGGAGCATACAGCGCAATACTGTGGAA
ACTGCCCGGATGGGAATGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGTCCAGACACCGACTAACGGAGGGGG
TCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGT
GAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATT
CGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTAGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCC
GCCTCCTGTGACGGGATCTTGAGAGTTGAGAACCTCTAGGGTGTAACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACGAGTAAAGGAAAA
GCTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATCACTACCAACACTAGATTCGCAATTCCCAACCTTCTCGGAGCTCGTACGGCCAATGT
AGTTCCGGTTCTTGAGGGCAGGAAGGCACTTGCGTGATACTGTGCAAATTGAGGTCTGTATTGATATTTAAGCCTATACCTGCCTGGGTTTCTACCTTCT
ATGTCTTTCATCTGCTAAATCCCTTACCAGGCTCGGCTGCATGTCCCTTCTTCCCTTGACCCATCATCCC