Description :
From Genome Similarity Track
Location :
Scaffold_11:75685- 83694
Sequence
8009 bases(100 bases per row)
CCGTCGGACTAAGTGCAGTCCTACGCCTGGAGTTTGTGCTATGGCCTTGATCACCACAAATCACTTCCCAGAATGTACGGCATGCCTTCACATCTCCAGT
TGGGGAGATCTCCCAGTCATGACATTGACTGTGTACAATTTAGTTGTGGGGCGGGAGTGATATGAAATGGAGTCGAAGCCGGTGTATTACGATGTCGATA
AAGAAGAAGCATGCTCGAGGAGACTACCCACTAGCTACGTACATTGGTGAAGGAAGAAATGTCGGACGCTGGAGGTTTCCGGTGGTCCTCCTAGGTCTGT
TCAGCTGACTCAGGCTAGGCGATTGACGAGGTCGCCTTGAATTTGCCTCGAAGGCGCGTGTGGATGGGTTCGTTCATCGATGGGTGTTTGGACGAGCGTT
CCAGTAGAACAGGCACCACGGCTCCGCCTCGTCAGTCGTTCGTAAGACGTGTAACAGATCTCCAGAGGCACCAGAAGCTCCCTTAGGGAACCACGGGCAC
GTTGCGATCAGCGGCAGGAAGAATGGCTCCAGAAGAATGTCCAAGTCGCACACATGAGCCTTGCACAGGCGGGCCACCTCTTCGAACACAGGCAGCAGCA
TCTTCACAAAGTGGGATCTCCGATTGTTACGATCCGAAGTGAACTTCACCTCCCAAGACTCAGCGCTGGCCTTGGAAATGGAAATCTCGATGGAGTGGGT
GATCTCCCAGAACACAAGCGCGCCACGATTATCGTTCCGAGTCAGCACATCGCGGATGATGGCCAGAAGAGGTTGGAAGCGGGGATCTCCAATGTCGAAC
GAGACTGGGTCGGGCATGTTATCCAGGAAGATCTTCCAGGGACTCGCTTTGTATAAAGCTTCGACCGAGGCTTGTGGCCAGGGCCGATAGTCAGCAGCAA
CGGCCAGCTTCCCCTTCTTAGGGTTGCATACCACGGCGGGTAGCAGCCAGTCGCGTGGTAAGAACTTCGAAGCGAGGTCTTTGGCTGTAAGCTGGTCAAG
GCGGTGACCTGCAACAACCTCCCACAGCCACGGCGTGACATCGGAAGAGCCCGCAGCTTCGCTGGATTCAGGTGGAATTGCGTGCGTGAATGGGCTTCGG
GCTGATACAGAGATCCACGGGCTGTCAGACGGAGATCTATGAAAGTCGCTTGTCTGACAATGAGGAGGAGCTACGTACCCATCGCCGTAGAGGAAGACAA
CTCAGCTGGCGCTCCCTCGGTAGTCGCAACGGCGCGCTTTGCACGCTTCGACTGTGACGTTGGATCAGAAGAGAGATCTCCACTTCGCTTTGCCGAGCCA
GACGGGAGCTGCTGCGAAGATGTTCGCGCTGGAGGATCAGAGGAGACAGGGCTCGGGGCCGTTGACGCCAGTGTGGCAAGAGACGAACGGGAAGAGTCCG
ACGCCACGCATCGTTCCACCTCAGGTTGCGGAGTTGGCGCAGGTACCAGACTGATCAAGTTGCGCAACGCTCCAAGGTGTTCCTCACGCTCCTCTAGCTT
GCTGCGGAGATCAGCAGAAGAAGCCTGCTCCTTCAGCAACGACTGTCGACTCGCATCCAGTTCCGCCTGCAAGTCGTCGCGAGCGAAGGAGGCCTCCGCT
CGCTCTCGTTCTACAAAGCAATAAACGCACAGGTCAGCACAAGAGTCAACCCGCCACATTAGCACGCGCGATCATGACCTGCAGCCACTGCGCGATCCTG
GGCTGTTGCGAGATCAGCCTGTCGATGCTCCAAACTGTTCTTGAAGTCGACGTTCTCACGCCGTAGAACGGTGTTATGCTGAGTCAGCCGAGTGATCTTC
CTCTCCAACTCCTCCAGTCGCTTCCCAGCCACCTTATGCCGCTGTGCGAGATCCGATAACGCTGTCGCTGTAGAGATCAATGCGTTAGTGATGCAACATC
AACAACCTCAGCACTTGGGACGACTTACCACCGTCTTGCGCTTTCTTCGACGCCGCCGCCGCTTCTCGTCGTGCTGCTTCTGCGTCCTCACGAGCTTTGG
ACGCATCCAAGCGAAGGGCGTCCATCCGTGGCGCTGCTTTGTTGACCAGCGTGCGCGATTGCGCCAACTCGGTCTGCAACCTGTCGATTGTCGCCTCCGC
TTGGCGCAATTGATTGCGAGATCTGTCTCGTTCGGCATTGGATCGTTGCAGGGCACGTGCCGTGTGTCCGTCACTAGTCCGATCATCATCAGTGGCAGCT
TCGCTGGCAGCCAACAGTCGGCCACCTGGGGTCACCGATGCAGTGGTAGGAGGGGTCCAGGTAGCCTTGATATCTGCCAGCTCGGCTCGTAGATCATCCG
GATCTCCGAGGGCGATCTCCAACTGACTGGGGACGACGTTAGAGGGCGATGCTGCAGCGGACGGAGTGACTTCATCGGCATCAGCTGAGCGCGCGGCGAC
CCGTGTGTGATCTGCGCGTACTTGTTGTTCAGCAGCTTCGGCTTGCTGACGGTGTTCTACTTCGGTGTTCAGGGCCTGCTGGGGATCCCGGAGACGACCA
TCGACTTCGTTGCGCACGCGTTGAACCTCCAGATCGTGATCATGGATGGTTCGATGAAGGCTTGCAGTGTGGCGACCAGATGCTTCAAGAAGATCCTGGG
CGACGTCAAGACGGCCCCGGAGATCCAGCACCTCGTGATCGAGGGCCGCGGGACTTGAGCAGCCTGGATAATGCGCGCGCGTTCCGATAGAGATGGCTGC
GAACCGGAGTATGGAGCCGCGGCCGGTATAGATCGACCAAGAGAGTGACAGGCGGTGCAATCTTCGTGGCTGTAGGTCGACGACGGGGCAGCACTCAGCA
GAGGGACGCCGGCGGCCGACGACGAAGGCGACGACGTGGGTAGAGAAGCAGACATGGTGCAGGGGCTCTACGCGTGGCAGCCACCTGCTCGATGGCCTCA
CGCGAAGAGAGGGCGGATGTCGTAATGCGGGTTGAAGGATTGTGAGGCGATGGACCCGGAGGTTACCCGAAGGTGACCCGAGAGTGAGCCACTTGAATTA
TGGGACACCCTTGCTCGGCGTCCCGTATACAAGGCCGGCGACTGATTACGAAACCCGATGGCGTATTTACGGAGATCCAGAACGGGGAGGCCCGTAACAA
GGACGATGACACCACACGGAGACAACATGACGTCATGAGGTAAAGGCGTGCAGCATACTGGTTGATTGGTTGGCCGGCACGGTAGATAGGCAGTTTAGTT
CAGAATTTCCAACAACAAGACAAGGTACTTCTTCATATTAGTCTTTGTGTTGTGCGGTTAGCGCCTACGTGTGTACTGTGACTGTTTCCTACCTACTTGC
GAAGTGTACGCGGGGTTCTGGATTGATTTGGCCTCCCCGGTTACCTTCTAGTAGCGTAGTGTGTTGCATTGTCTGGACTCAGGAGATCAGCTCTCAGTGT
TCGACAGTAGGACACTCTAAACGGTTTAGTAAGGTATTGATGTGCGTCTCGCACTTTGGTTTGGACCCGCAGACTAGCTGCGGCAGGAGATCTCCAGTAG
ATCTCGTACATATTGTACAACAAGTTGTCGTACAGTGGGAAGAGTTACCTCGCTGTACAAGTGCATCCGCGACAGAGTTAACTTAAGTCTCTGCCTGCGA
GTGTAAGGAACCCCATATTCACCCCATCATATTACACGTCTTCTAGGAATTACGCTAGATAAAGATCCGAGTCTTGCTACAAGGGTACACAAGGTGAGGC
CTAGAGATCTAGGGACTAGTTCTCGTTGTCTTTGGGTATTTGGCTTGCAGGGGTAGCCCCCCCCCCCCCCCCCCGTAGTTGCGTGGCAGGACACGTGCGG
GAGTTTATTAGTTTTTTATCTGAGGGACTCCATCACACTGTGCCCGAAGGCCAACAGTGCACGTTGTGTCTTCCGGGTGCGGTGCGCTTGAGCGACCGCG
ACCTAAACGGGTACACGACGACTCGTGTACCTGCGAGTCCCAAGGATCTCCGTGCCAAGTTCTTCGCACGTGAGGAACGCGACGATCGTGGGACCTCGGG
CGCTGTAGGTGACCACAGCGATCGCACTACCTTCGCGTCGGCAGTGCGTGGTGAGCTTCGTACGCCCTCACCATTTCCGGAACGTCCTGCAGCAGGACGT
CCCGCGGCTCCCATGTATCTTGGTGGGGCGGAAACCCTCTCCAACGAATACGATAAAGAACCGGCTGCCGGTTCGTTTCAACAAAACCAATGAACCCTTC
TCGAATTCATTAGTGTTGCCCCTGCCAACATTGTCTGCGTTCAGCTTCTGTCGGTCGACAGAAGCTGCAATAGCGTCTTGGACAAACCGAATGACGGCTT
GTCTGCGCTGCACGAAGTTGATTGCGTCCGAGCTGAACTCGTTCAGCTCGTTTCTAGCAGTAGACCCGGCCTCTGCGTTCGTCTTCGCGGTGTCTGTACC
CTGCACAGACTCGTTCTTTTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTCTTGGTCTTGTCGGCGTATGTGCCCTGCACAGACGCGTGCTTCTTCTTCT
TCTTGCGCGTAGTCGCGGCTGACACTGTGCAAGTGTCAGCGGCATTCTGCGGCTGCTGCGTTGCAGTCGTAGATCCTCCCCCACTTAAGGAAGGAGCCGC
CATCCCGAGTAGACTCGGGAGGCGTGGGTGCCTGATGGTATTCACGTAGAACGGTGTATGCCCGGTCGAGGCATGCACCGAGTTGTTGATGGCGAACTTC
GCCATCGGCAGGCATTCGCTCCAGTGTTGGAACGAGTGAGCGTAGCTCTTAAGCACGTCTACGAGCACGCGGTTCACGCGCTCGGTCTGCCCGTCCGTCT
GCGGATGGTCCGCAGTCGACATCGAAAGTTGACTCCCAAGAAGTGTAAACACTTCTTGCCAAAGGTGTGCAGTGAAGCGCGGGTCTCGATCCGACACAAT
GTCGATCGGCATGCCATGGTGTTTGAACACCACGTCAACGAACAGACGCGCCGTCTGTTTCGCAGTCACTTCAGCGGGTACCACAGCAAGATGTACCATC
TTGCTGAAGCGGTCAACAAAGACCACAATGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAACACTCCC
GTGGAGTTGGTAGTGGCTGCAAGGGAGCCTGCGCGAAAGGCGCAGACTTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTGTA
CTGGTGGGCCCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCGTACATGATCCTG
AGTCGCAGGTCATGGTCATTGGGCACGACAACGCGGTCCGCGTTGTCGTCGACTGCATTGTAGAGTAATAACCCGTCGTGCACCCGATAACGGTGTGCAC
GAGCACGAAGATGCTTCGGCAACTTCTGACGAGCTTTGTCAGAAGGCGCTGAGCCGTAGGCAAGCAAGAGCTTCGCGTCCACGTCGTGCGCGTACGCGAC
CTTCACGTCGTCCAACAGTGACGACGTTGGGGTGCTCGATCGCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACGCGAG
AGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAAGGAGAGCCATCTCGCCATCCGTTGCGAGATGT
GCGGCGACTTCACAGCCGTCCGCAACGACGCGTGGTCCATATAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGAGTGCGTACTT
CATGGCAAGGAGCTCCTTGTCATGTACCGGGTGGTTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCACGACCCTCGTGATCG
TGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCGCACACAACGTGGAACGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCCGTCA
AGCCCTGTTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCATACTTGC
ACAAGTACGTGGCCAAGCCAAGGAACTGCCACAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATTGATCACTCTGACCTTCTCAGGGTCAGGGCGGAC
ACCGTTTTTCCCAACGAGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCAAGCAGCTTTCGGAGGTGCACCTTGTGCTTCTCAACATCGCTCA
TCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGT
CGCAGGGGCGTTCTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACTGCCGTGAGAGGGATATCGCTCTCACGCATG
AGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATGACATCTTTTCGAGGTATCGGTGTCTGCA
CCGGTATCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCAGCCGCCCTATGGCTTCTTGATACAGAACGTCGGAGCACTGTGCGGGGATTT
CGATTCCCGCACTTGTCCAGCTTTGCGACGACTCTCAAAGAAGTCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTAC
TTCGTCCCCGGCACGAGATCAATCTCGTGCTGAATGCCCTTATCCTGCGGATGCTCCGCAGGGATCTATTCCGGAAGCACGTCCGTGTACTCCCGTAAGA
TCTCGTAGTAGGGACACGTTGAAAACGAGTCCCAGCTCTGCTCGTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGTGGTGCT
GTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCAAATTTGCTCGATGCGTCCATCGTGCAAGTCACGC
GCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAATCCGGCACGGG
TACGCGTCAACGTCTCGACGCCTGGCTTCTCAACCTTCGTCTGCCTGGCAGACATTTCTTGTAGCGTCTCGGCCCCGGGCCGAGACTTGCGCAGCGACCT
TCGCATGCGCCGTCTTCTTGTTTTGCGGAACCCGGCTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTATGTAGTACCGCCG
GCAAATACAGTCCGCGGGCAAGCGACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAGCATGCGAGTTTTTCCGGTG
CGGGACGTTTGCAACCGTTCGCACCGCCTGCAGTGTCGGCTCCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTTATTGGCGGAGCCCTCCATTAT
GGAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAATTCGTCCAAGCTATCGACTCCCGGAGTCGATGCGACTTCAATACCTCGACGCCAAACATGACAT
GGCGAACGCGACCTTCGACAACGGGTCGACGATGCGTCGAGCCGCAATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGACAGGCTCGCCCTCTCTTCCA
GCGTAACTGCTCACATTGAGCTTCAGCGATTGCGCGCGTGGTGTCGTCCCGGACGACACCGCGGTAGTAGCAGCAACATCGCGTTGCTCCTTCAGGATGA
AACCCAGAGCAACACCGTGTTGCTCCGTCGGCGTTAGCGTACGCAGCATCGTAGCTACAGCCGCCTCACCAATGACTGTTGACAGCTTCCCACTCTGGGT
CCGACAGGT