Description :
From Genome Similarity Track
Location :
contig_23:75684- 77592
Transcript NameFunction/comments
g5067.t1hypothetical protein PHYSODRAFT_346079
g5068.t1myosin-like protein

Sequence
1908 bases(100 bases per row)
CAGACGGCGCCAACGACATGTGCACGCTCAACCACCTGCACGAGCCGGCCGTGCTCAAGAACCTCGAGCTGCGCTTCGCCAAGAAGATGCCGTACACGTA
CACGGGTGCTATCTGTATCGCCGTAAACCCGTACCAGTGGCTGGACCTGTATGGTCGCGAGCTGTACCTGCAGTATCTGGAGCAGCCGCGCGACTCACTT
GCCCCGCACCCGTTTGCCCTCTCGGCCACGGCCTATTTGGACATGAAGCGGACGCAGGTGGACCAGAGCATCCTCGTGAGCGGCGAGTCCGGCGCCGGCA
AGACGGAGACGGTCAAGATCATGATGAACCACCTGGCATCCATCTCTGGGGGTGGCAACCACGGCACCAAGGTCATTGAACAAGTGCTCAAGTCCAATCC
GCTGCTCGAGTCGTTTGGTAACGCCAAGACAAAGAGGAACGACAACTCGAGTCGGTTCGGAAAGTTCGCGCAGCTGCAATTCGACACCCTCGGGTCGCTC
GTCGGCTGTCTGTGCGAGACGTACTTGCTCGAGAAGAGCCGCGTCGTGGGCCAGACTGAGGGTGAACGCAACTATCACATTTTCTACCAAATCTTCTGTC
TCTCGGAGGAGCGCAAGTCCAAGCTCAAGCTGAGCGGCGACGTCACGAGCTACAAATACGTGACGGAGGGCGCGGACGCCGAGCTCACGGGTATCGACGA
CGTACAATGCCTCAAGGAGACACAAGAAGCCCTGGATATCATTGGCATTTCGAAGGAGGAGCAGAACGGCATCTTTGAAATTGTGGCGGCGATTCTGAAC
CTGGGTGAGGTGGAATTCGAGGCCAACGGCAACGACAACGAGAAGTCCCACGTGAGCAACGAGAGCATCGTGGACAACGTGGGTGCCCTGCTGGGCACTG
AAAGCGCGGCGCTGCACTCGACACTTCTGGAACGCTCGATCACGGCCGGTTCCGAGTCGTACACGATCCCGCTAAACGCCGAGCAGGCCTCAGACCTGCG
CGACGCTTTGGCGAAGGGCATGTACACGCAGCTGTTCGACTGGCTGGTACACCGCATCAACAAGGCTATTTGCTCCACGAACAATGTGAAGACGCACATT
GGCCTGCTGGATATCTTTGGGTTTGAGAGCTTTGACCAGAACGGCTTCGAGCAGCTCTGCATCAACTACGCTAACGAGAAGCTGCAGCAGAAGTTTAACA
GCGACGTGTTCAAGGATGTGCAGCAGGAGTACGTGGATGAAGGCATCCCTCTTACGCTCGTAACCTTCGAGGACAACCAGCCGATTCTGGACTTGATCGA
GGGACGAATGGGTATTGTCAGCATGCTGAACGAGGAAGTGCTGCGCCCCCAGGCCACGGATAGCACATTCGTGAGCAAGGTGCTGGACGCCTGCAGCAAT
CACCCCAGCATCGAGAAGAACAGAATTAACCCGCTGGAGTTCACTATCCACCACTACGCCGGCGACGTCACGTACAACGGCACGGGCTTTTTGGAGAAGA
ACAAGGACACTCTCCCCACTGACATGGTGCAGCTGCTATCTGGCAGCCAGAATGACGTCATCTCGGGCATCTTCACGCCCACGCAGAAGGGCAAGCGTAA
CAGCCGTGGCAAGCACGGAAAGGAAAGTCGCCAGAAGGGTTTTCTTGGTTGGTAACACCATTGCTGGCGCCTTCCGCAAGCAGCTTTCGGAGCTAATGGA
GACCATCAACAAGACTTCGTCGCAGTACGTGCGATGCATCAAGCCGAACGCAAACAAGAGCGCGGTGGAGTTCAACCGCCTCATGATTGTGGAGCAACTT
CGTTGTGCCGGTGTGATTGCCGCTATCCGAATCAGTCGTGCTGCCTTCCCTAACCGTTTGCCGCTCGTGGAGTTCCAACAGCGTTTCCAGATTATCTGCC
CGTCCGCG