Description :
From Genome Similarity Track
Location :
Scaffold_40:7567- 9169
Transcript NameFunction/comments
Sapdi_VS20SDRG_11184hypothetical protein

Sequence
1602 bases(100 bases per row)
CTTGTTTGCAAAGTTTGTTTGTCGAGTCGAATTTTATACTTTGTCGAATTTTGAGATTTTTGGATGCCAATTTCAACCAATTTTTAGGTGTCGATCTCGA
CGCTCGGGTACGGCGACATTGCGCCGCGCAGCCGGTTTGGCCGCCTTGCCACGTCGCTCATGATCATGCTCACGTTCGTGCTCGTGCCGATTCAAGTCAA
CAAGTTGATTGCGACGATATCGTCGCACTCGGGGTACACGAATTCGTACAAAGAGTACCGAACGCACACCCACGGCATCATCACGGCGGGCGGCGAAGTG
AGCGCCGGCGCGCTCAACAACTTTTTACGGCAATTTTTCCACCCCGACAACCCCAACTGGAACGAAAAGGTATATATATGTTTGCGACAACACAAAGGGC
TAAACGATGTACAGATTGTCATCTTGCACCCGTCGGCGCCAACGAGCGAAGTGAAAAAGATCGTACACCAGTACGAACCGCGCGTCCAGTACATTGTCGG
TTCGGCCATGAACGAGCTCGATCTGGAGCGCGCGATGATCAGCCGCGCGTCGATTTGCTACGTCATGATCAACAAGCACTCGCATCGGTCGTCCAACGAA
GACCAGTCGAGCACGCTCTTGACAGCTGCGTTTCGCGGCTCGAACGCCAAAATTCCCATCTACTCGCAAGTGTACTCGTCCCAAAACATGGGCCACTGCA
CGCTCTCGGGGGCGTCCGGCGTCGTCTGCATCGAGCGACTCAAGCTCGGCGTTGTGGGCTTGAACTGCTCCATCATGGGGCTCTCGACGCTCCTCTCCAA
CCTCCTCGACACGGTCTCGCCCAACGTCGAGTTCTTGTACCCGTCCGACTCGTGGGAGGCGGCCTATCTGCGCGGTCCGTGCTATGGTCGTATCTGTTGT
GTGTTTACATTCCCCTAGGTTACATTCACGAGATTTACAAAGTCGACCTTCCCCGCACGTTTTCCGGGCTCACGTACGGCGAGCTCATTTTGTTCTTATT
TGGCACGATCCAAGTGATCCCGATCGCGATGCTCACCGACCAAGGCGCGCGGATCATGCCCATGGACTTCAAGATCGGCACGACGGCCGACCCGACCATC
TGCTGCACGCTCTATGTGCTCGCGGCCGGGATTTCCGTCGCGGACCGCATCGCCGAGTACCCCCTCGAGCAAATCCGCGAGTTTCGGCAAACGCTGCGCA
AGCAAGAGCGCTATATGGCCGAGCGCGCAGCGAACCGGCAGCGCACCGAAGCGGTGATTGTGGTGCCGCCCCCCGAGGCCCCCAAGCACAGCGAAGCCGT
CATCATCAAGCCCAAGCTCAGCCCCGACGCGGGCGCGGCCGAGCCGCGTCGAGGGTCTATCACCGAAGAGCAACAGCCCGTCGCCGGCCTCAAGGTCGAG
GGCTTTGCTGCGATGCGTAAAACCCTCCATGGCGTTAAGCACGCGTTTGAAAAGTCGTCGCCGTACAAGGACTTTCTGGTTCATTTTGTGGTGAACGATC
GGTCAAGTGACGGGACTTTGGTAGGACAAGCCGCTGCCCGACGTACTCAGCGGTCACGTGGTCGTCGTCGGACTGCCGCTCTCGCTGCACGACCTCATCA
TG