Description :
From Genome Similarity Track
Location :
Scaffold_20:756452- 758735
Sequence
2283 bases(100 bases per row)
TGCGGTAGCTACCGCGATGTTACACTGCGGTAGTTACACTGCGGCACCTACCGCAAAGTCACAATGTTGAGAGATGTATTTACCGCTGTAATTTATCTGA
AGCGCGCAGTTATCGCGTATGACCGCGGCTGTGCTTGATGTGCGTATGACCGCGGCTGTGCTTGATGTTAAACGTCCTGGTCTCGTACTCCGAGCTCATG
TGCAATTGCAGCTACGTTTTGAGACACCCAATTGAGCGATTTTTTGCGAATACAGCGGATGCTGTCAACACACTTAATCGTCTCTTCGACTGCCTGATAC
TTGTCGAACGCCTCGTGGTTGCAAACTCAGCTAGCGATGGTCTTTACAAGATCAATAATTTTTCGTCGTCGGTTGAAGAAGCGTCTCTCGTGATGGTCAC
ACCACTTGGTACCGAGCTGTTGCTCCAGCGTTTCAACTGCATAACCACCAGGGAGGCCACATGTCCATTCGGTCCACAACTCACGGACCGATTGAATGCC
CCGACTGAGTCTGTAACTGGTAATCGCAGAGGGGTCGCTCGGTGTACTGCTACCTGTGCTAGCTCCGGAGGCGGCTTGGGTGGCGCTGGGGGTTGTCGAT
TGTAAGCCATTCACGATCTTAACTTCCACAAATGCTGATCCATTCCTGAGTGGGGCAAGAACTTCCATGACATCTGCTACACTTTCACCGCGTCCAGGCT
ATTTCGAATACCACTCAATGATGCTCTCATCTCCTGTCGAACACCATCGAGCGTCGACTTCAGCGCGGGCATGGCTTTCTCAAGCTGACGCTCGGTGGGG
TCACTAACGTGGTTCATGGCATTCTTCATTTCCAGCTGAAATTGTTTAAAATCATCGCTCTTGAAGATCTCATTGTTCCAAATCGGATGTCCCGACATTT
GCTCGGACCAAATGGCAGCATCCTGTAGAATTACGGTGCGCAGATACTGAAGCAGCTCGAGAAAACCACCAGCCGCGATTGACTGTTCACATTCACCTGA
TGTCATCTTCGACTGCCACTCCTCCACCAACGGAAAAATACGTTTCTGAAGAGCTTGGGGAGGATCAACGCAAGTACGCGCCAGAAAATAACTGCCTCTT
CCTGGTTCAAAGCCCGCAAGCGTTCGCATTGCTTCTCGCGGGAGTGAGGTGAGGTAACATTTCTCCATCGCCTGAGTATTCCACCTCCCTAGGCGCCGTA
TCTGAGCTTCACTGGCACCCCCAAGGTATGCCATTCGGGAGCCCGATCCTCTGCCTAGATGTGTTTTGGCCCTGCTGCGTAGACCGATGTGGTCGAGCGC
GTCAACAATAACCGCCCGATGAACCTTGTACGACATTGGCTTGGTTGGATCTTTCCCAGTTTTTAGCAGTTTTATAGCATACCATTGTTCCGACTTCGTG
AAATCAGGAAACGACTCTTTATCCACGTGCCATCGCCAAAACAGATAGAATCCGAGCAATCCATGACCACAAATCTCCACTTTCTTACTGCGCATACATG
CACCCACTTCAATACGACCAACTTGGTTGGTTTTCCCTTGTGTCATGACCATCACCAGCGCCCGACAAACACTGTAGCCTTCATTTTCCAGTACAATCGA
GTGAAGATCAGCTAGCTCCATCAGCCGAGCAGACTCGCCACGCATTAGCGCATAGTGAGACAACAGGTACGCCAGCAAATTCCTCATGCTAGTTCCAGGG
TCGTGCGACGAGGTCCAAAAGTAGCGAGCAATCTGTTGTAGCTGATCCGTTGTTGTGTAGCCATCCAGTAAAGTATCAGCTCCTCGATCTGCAAAGTTCT
TACGCCGCAGCTGGTCCTCCTCGTACGTCGTAATTTTGAGAAGTGCTGTAACAGCGCCATCTCGAGGAGATGGGTTGGTGTTGATATTCAGTCGTTTCTG
TTGCCGCCACAAGTCAACCATGGCAGCCACATAGCTGTTGACAGTCGATTTGCCAACTTTTTCGCTTCTCCCTCCGTGACCCTTTCGTCGCTTTTCCCTC
CCAATCACGCACTCCACGAGAAAAAGGTGAAGTTTTGGCCCTGTTACTGTGTACCGAGTGAGATCACTGAAAGCCGCGCCCTTGTCGTCACACCACCGCT
TGAACTCGTCCTGCTTGCTTGTATATGCCCTCGAAGTGTTCTGAGGGCGAATGTTAGAAGATTTTTCGTAGGTGCGGTCCTTACGGTACTGCTAAAGTTA
TGGGTCCGGTACGGACCTATTCATCTTGGTGATCCCGACACCGTTTCCACGATAGCGGATATTCTACCAATCAGCAACAATCA