Description :
From Genome Similarity Track
Location :
Scaffold_99:75631- 82246
Transcript NameFunction/comments
Physo_141468reverse transcriptase
Physo_141469reverse transcriptase
Physo_141470reverse transcriptase

Sequence
6615 bases(100 bases per row)
CACTTCCTCGACCTTGGTGTAAGGTGCACCAATGGCTACATACATTTACGACCACCACGACGGGTGGTCCATACACATTTAGGATTCCTATTGGCTGAAA
GCAGCATCTTTTAGCCAATGAGTGACTTGCATGTTAGCAGAATCCTGCCAACCAGCCGTTGGCAGATTCCTAGTTTAGAATATTACCTTTAGAGGAAGTC
AGAAACATAAAACAAAAATAGCAGTACTCATCTTTTACCAAAACACGCTACTTGGAGTCTTTATCTTGTTTAAAGTATACTCGTGGATCTCGAGTATACT
TAACTCAAGTAAAAGAAACCTACGCTTCCTCATACACGTGCGCATACGTGTAAGCTGTAGTAGTGAGCCACTACACCTGGTAGCACTTTGTAGTCCGTCC
AACGACCGACTACCTGAACGTTCGTACGGAGCTGTACGAACGAGGAGCCGAGAACCTTTTCATGAGCGAGGAGGTGCCCATGGAAAGCTCCACTTCGCCT
GCAACTCATGTTGCACGCGCTGACTGCCTCCACCTGTCGGATCCAGAGTGGGAGGCACTCCAACGACTGTCAACAGTCATTGGGGAGGCGGCAGTAGCTG
CGATGCTGCGTACGCTATCACCGACAAAGCAACATGGTGTTGCTCTGGGGTTCATCATGAAGGAGCAGCGTGATGCTGCTTCCTCTACCACGGTGGCGTC
GGATACGACACCGCGTGGACAATCGTTGAAGCTAAACGTGAGCAACTATGTCGGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCGAACTCGACACT
GCCATCGCGGCTCGACGTATCGTCGACACGATGTCCAAGGTTGCGTTCGCCATGTCATGCCTTGGCGGACGAGCGAGAAGTTGGGCGTATGGGCGCCGAC
TCTCTGATCCTACGTGCTTCAGCACGTACGAGGGTTTCAAGGAGGAGCTCAGGCAAGCGTTTGAGCCCCCGCAAAATGAGTTTCGGTCGAGGGCGGAGTT
CCTCGACCTACAGCAGGGTAAGTATGATGTTCATGCTTACGCGCAGAGAGCACGGTATTTGGTCTCGAACATTGTGGCCAATCCGATAGATGAGGCGACC
AAGGTCGTCACGTTCATGAAAGGACTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTATCCGAGTACTCTCGAAGCTGCAATTACTCTTGCAA
TGCATGAGGAGTTTAGCCTGCGACAGGCTAAGCTGCATGCGAATGCGCCGAGGCTGCGACCGCCTCCGGTTGCGATAGCGGGAGGTCCGGAACCAATGGA
CCTCTCGAATGCAACGGCTGCTGATTATCAACAGCAACAAGGAAGTAATGTACGATGCTTCCGTTGCGGAAGGATCGGTCACTATGCCCGAGAGTGCACG
GCACCCGTGCACCGAGATGGTGGTCGACGCGGCGATGCCGGGCATCGTCGCGGACAAACAAAAAACGCTGGAACCTAGTAGGCGCGAGGCGCCCTACTGG
TGAAGCAGTCACGCGTGTCCAACTCGGACATGCGACACTGAGGACTGCAGCCCCCAGTGAGGATCCTTCTCACTGCAAAATGCATGATGACAAACCGAAC
CTTGTCATCTTGGACGTGTCTTCGAAGAGAGAGAGCAACTCTCTTTGTGCTTTGGTTGATTCGGGCGCGTCGAACAACTTTGTTCGACTGCGAAGTCTAT
CAAGGCTTGACTTCGAGGAGGTAATTACACCTCGACGTATGTTGGAAGTTCGATTGGCAACGGGTGCCATCGTTAAAACCGAGAAGCGCATGGTACGCGT
GCGCTTCACGTATGAAGATCAAGCGTTTGTCGAGACCTTTATCATCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCACGG
CATGATCCGGTCATCGATTGGGAGAAGCGCACTCTGGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTACGCACGCACCGA
CAGGTGCGCGCGACTCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGTGCGCGAGCACGCGCGCAAGGGCAGCAAGCGTCGGC
GTCGCCGCCGACGGCTGAAGGAGAAAATGTGTTGATCTCGGAGATCGACACCCACTTTTCAGCGAATCAGGAAGAGTCTCCGACATCAAGGGGTACGGAT
GACGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGATTCTGATTGGATCAGTTTTGACCAATAATAAGAGCCAAGGTGACGAAACGACGTCGA
CTCCGGGAGTGGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAACCGACGCATCCTCCGTAATGGGGGTCTCCGCCAATGGTTGGCGTCGAGGTAT
TGAAGTCGCATCGACTCCGGGAGTCGATAGCTTGGACGAGTTTGATTCGTCGGCTCGAGGAGCCGACGCACCCTACGTAATGAGGGTATCCGCCAATAAC
AGGCGTCGAGGTGAAGATGGCGTGTCGACTCCGGGAGTCGACGCTGCAGGCGGTGCGGACGGTTGCAAACGTCCCGCACCGGAAAAACTTGCATGCTGTC
GTGCAGCCGGGCTGCACGAAGAAGCGCCGGGCGACCAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATGAACCCGCCGGCGGTATACAAGAAGAACACCC
GTCCACGGCTGGGCCTGGACGAGGTCAAGAATCATGCGAAGATCGCTGCGCAAGTCTCGACCCGGGGCCGAGGTGCTACAAGAAATGTCTGCCGGGCAGA
CGGAGGCTGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGACGCGTACCTGTGCCGGGTTCCGGTACAGGGAGATGACTCTCGCTAACCCTCCGACGCT
TGCGTCGGACTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTCTCGGACGCC
GAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGAGTACCACTGAGAGCGAGGCCACTCTCAGTGCGAAGACTAAGAAGGTGCGCT
TTGAGGAGCAGAGCTGGGACTCGCTGAAGACGAGTCCCTTCTACGAGATTCTACGGGAGCACGCGGACGTGCTTCCGGAAGAGATCCCTGCGGAGCTTCC
GCAGGACAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTCAAAGCGATC
GACGACTTCTTCGAAAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAAACACAGGGCGGTT
GGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGATACCGGCGCAGACGCCGATAGCTCGAAAAGATGTCATCATCGATTCGATGGCCAGGAG
CACTATCTACAGTGCTCTTGATCTGCGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCTGTGAGCGCGCCGAGCGGCATG
CGCTGGGAGTGGCTGGTGATGCCGCAAGGGCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTATTGCGCTCGGTGCGCGACTTCGCAT
CGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCAT
GCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGTGAGCGAGATACCCGTGCTCGGGGTCTCGTTGGGAAGAACGGTGTCCGCCCTG
ACCCTAAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGTAAGTACGT
GAAGGACTACGCGGGCATGATACGCCCGCTGTCCCAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTC
AAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCAGTCCACGTTGTGTGTGACGCATCCGACTTCGCAATCGGATGTGCGT
TGATGCAGCACGATCACGAGGGCCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAACG
CCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGCGTGACTGCGGACGGCTGTG
AAGTCGTCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCGGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGG
CCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCAATCGAGCACCCCAACGTCGTCACTGTTGAA
AGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGATCTTGCTGGCCTACGGCTCAGCGCCTTCTGCCAAAGCTCGTCAGAAGTTGCCGAAGCAT
CTTCGTGCTCGTGCACACCGTTATCGGGTGCAAGACGGGTTATTACTCTAAAGTGCAGTCGACGACAACGCGGACCGCGTTGTCGTGCCCAATGACCATG
ACCTGCGACTCAGGATCATGTACGAGTAGCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTTCTTCTCACGCGAGACTTCTACTG
GGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTATGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTA
CCGACTCCGTCGGAGTGTTGGTAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACC
GCTTCAGCAAGATGTACCATCTTGCTACGGTACCCGCTGAAGTGACTGTGTTCGTTGACATGGTGTTCAAACACCATGGCATGCCGATCGACATTGTGTC
GGATCGGGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGATGGTGCGGACCATCCGCAGACGG
ACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCGGAGTT
CGCCATCAACAACTCGGTGCATGCCTCGACCAGGCATACACCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGACT
CCTTCCTTTAGTGGGGGAGGATCTACGGCTGCAACACAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAAGAAGAACA
AGAAGCACGCGTCTGTCCAGGGCACAGACGCCGACAAGACCAAGAAGAAGAAGAAGAAGAAGAAGAACGGGTCTGTGCAGGGCACAGACACCGCGAAGAC
GAACGCAGAGGCCGGGCCTACTGCTGGAAATGAGCTGAACGAGTTCAGCTCGGACGCAATCAACTTCTTGCAGCGCAGACAAGCCGTCATTCGGTTTGTC
CAAAACGCTATTGCAGCTTCTGTTGATCAACAGAAGCTGAACGCAGACAACGTTGGCAGGGGCAACACAAATGAATTCAAGAAGGGTTCATTGGTTGTGT
TAGCTACTCAAAACCTGCCTAAACATGCAGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACTGTGCTGGAACGGCACGG
CAACACCTACACACTGGACATACCGTCTAGTATGCGCCTCCATCCGACGTTCTACGTCGGACGGCTGAAGCCATACCTGCAGTACGAGCTACCTAGCTCG
GCTGAACCGAAGCAGAAGACTCGGCGGAAGCCGTCATCCTCACCAGCGCGAAGTCGCGCTGGAGCAGCGGGTCGAGTTAATAGTCCAGCTTGGCCGGAAC
GATCGAGGCGGCCTGGGAGGCCGCCGCAACCTGAGGAAACTTCAGAACGCCGAAACCAGCGCTCTGGAACTACTCCACGACCGGAACTCGTTCGTGGGGA
GACGCGAGATCAGGGTCAACACCAAGTTGACTACACACGAGGCGTGTTTTCACCGCCACCGCCGCCAATTCGTGACGAACACGGCTCAACGCGATGGATA
GTTGAGCGGATTGTTGGTCACAGTATCCCGAGAACGAACAGGCAACCGGTTCGTTTTCGTATCCGTTGGAGAGGATTCCCTCCCAACCAAGATACATGGG
AGCCGCGGAACGTCTTGATCGAAGACGTCCCGGACATGGTGAGGGCGTACGAAGCCCACCATGCGCTACACGCTGGAAAGTAATACGAGCGCTGTTGTTA
ACAACAGCGCCCGAA