Description :
From Genome Similarity Track
Location :
Scaffold_112:75627- 76661
Transcript NameFunction/comments
Phyke_g4267hypothetical protein PHYSODRAFT_381602

Sequence
1034 bases(100 bases per row)
CTAGTGCTATGGACTTCCGGGGACTAGCAGCATCGAACGAGATCAATTTCAGGTGGATGCTCAAGAATTCACGAGGTTCCTTTACAACGTATTCCCGTCG
AGCAGACACATCGGGAATGGAGACCCCAATGTTAGGCGGTACTGGGAACAGGACTCGCACCACGCAACAAGTcttggctgctggagaaattcGCTGCAGT
TTGCAAGAAGTTGCACGAGTGCTGCACACGACAAACGACTACGACCACAACGCTGCCATGAGTGGCCTCTATCGCAAAGATTTCATCTACGGCTCCGTAG
TGCATGTCGTTCCATCCCCGTTCGGTGACGAATTGCAACTGGCAGATCTActcaagcaagaagaagactcgGCAGCTACCCAAGTGGCGGTGAAGACCGG
CACGTTCGTGCATAGCAAAATGTTTTCGCCCAACGAGCAGTGGTGCTTCCTCGAACGGTCACGATATGTTCAAGCTGAGCGTTCGGACGCAAGCGACCCT
GTTGATTCGAGTGTCCCGCCTAAAGTCGATTCATTCACACTCACCCTTAGCTCTTTGGATGAAAATGAGCTCGGAGCTGGCAAGGTCAATAACCGAGGCC
GCGTGAACACGCTACACGGTATGAGCGCTGGGTACCTTGTTGAGCAGGTAGTAGGTAGCCGCTATGTACGTGTGATCTTTTTCGGGCAGTTTGATGGTGG
TGACTTAGGCCAGCCAGGACGAGCTAGGCCAGCTCAAATGCGTGCTAGGCTAACACGCCTGGCTAATGGTGCATGCCACCTGCCTGAGGTGATTCGCCGC
CGTCGATTTGGAGCGCAAACGATGGCGGACCGACAAGCTTTCCCCGCCAAAAACTCCCGCTGTATCTGCTGCACGAAGTCGCTGCACCTACTCACGCGTA
AGCACCGCTGCCACCTTTGCGGTCACTTTGTGTGTGACCGATGCTGGTCTCTTGAAGAAATGGAGACGCAGACTTCTCGCCGCATCGCCCCCGTGCGTGT
ATGCTCACGATGCCTTGAGTTCGTGGACAATGGA