Description :
From Genome Similarity Track
Location :
Scaffold_22:7562- 9831
Sequence
2269 bases(100 bases per row)
ggcagtggccactgccgcgtgaacaagttcaagcgatcgacgacttcttcgagagtcgtcgtcttgcaggtcaagtgcgggaatcaaagtccccgcacag
tgctccaatgttctgtgtcaagaaggcacagggcggctggcgcatcgttcatgcgtacaacaagttgaacgatgcgacgataccggcgcagacgccgata
ccgcgaaaagatgttatcatcgattcgatggccttgagcactatcttcagtgctctagatctgcgtgatggattctatcaaatcctcatgcgtgagaggg
acatccctctcacagcggtaagcactcccagcggtatgctgtgggagtggctcgtcatgccgcagggacttaagaatgcccctgcgacgttcaatagatg
tgtgactcatctattgcgctcggtgcgcgacttcgcaccgagctacttcgacgacgtgttcgtccacagccgggctgtgaacgggaagacggacattgag
atgcacaaggtgcatctccggaagctgctagagcttatgaggaagcataagctctatgcgaacctgaagaagtgtatcttcggggcgaacgagatacccg
tgctggggtgtctcgtcgggaaggacggcgtgcgccctgacccagagaaggtcagagtgatcaatgaatggcccacgccatccaatgtgaaggaactgag
gcagttccttgggcttgccacgtacttgtgcaagtacgtggagaactacgcgggcaagattcgcccgctgtcacagcttcttaagaaggaagctgagtgg
atttggacgaccgaatgccagggggcgttcgatgcagtcaagcagggcttgactgaggctccgatcttggccgtcgccgaccaagatcgtccattccacg
tagtgtgtgatgcatccgatttcgcgatcggatgtgcattgatgcaacatgatcacgaggggcgtgatcgtgtggtctactaccagtcgcgtcagctgaa
gccagctgagcgtaactatcccgtgcatgacaaggagctccttgccatgaagtatgcactcgcaaagttccgagtgtatctacttgggagtagaccgttc
gtggtctacaccgaccacgcatcactgcgtacggcgattaagtcgccgcacatctcgcaacgtatggcgagatggttgtccttcttcgcggagtacaact
tccgggtggagtacaaacccggaagactcaatgtagtggccgacgcgttatcgcgtcgacctgattatacggagacggtcgacgccaacagtgttggcgt
cgtgaggacaagtgtgccgtcgtcaacgttgattgacgacgtgaaggacgcgtatgcaagggatgcagacgcgaaggagctgctggagttcctcgcagca
ccttccgacgaggcacgtcggaagctaactcctcaccttcgagctcgtgtacaccgctatcgtgtacacgaagggctactgctatacagtgcagtagacg
acaacgcggatcgcattgtcgttccgaatgatcatgatctgcggctgcggatcatgttcgagtaccacgatgcccctacggcagggcatccgggtcgtga
gaagacatacactcttctcacacgtgacttctactggcaccaccagtacaagtgggtacgcaagtacgttcgtgcttgcgaggtttgccagcgcgtgaag
cctgcgccgtttacgcaggctcctcttcaatcacttccgactccgtcggagtgttggcagtccatgtccatggactttgtcttcggtcttccgcccgaca
acaagcggaggacaggcatcgttgtctttgtggaccgattcagcaagatggtccatcttgctgccgtcccggctactgttacagccgcgcagactgcgcg
actgtttgttgacatggtgttcaaacaccatggcatgccgctcgacattgtgtcggaccgtgatccacgcttcacagcgcggttctggcaagaagtgttt
acacttcttggttcacagttgtcaatgtcgactgcggatcatccgcagacggacggccagactgaacgcgtcaaccgagtactggttgacgcactgaaga
gctacgcacactcgttcccgcattggagcgagtgtttaccgatggcagagtttgccatcaacaactcagtgcatgcctcgacagggcatacaccgttcta
cgtgaatgccatgcggcatccacgtttgccgagcatgctcggcggggtagcttcctccttaagtggggg