Description :
From Genome Similarity Track
Location :
Scaffold_189:75615- 78154
Transcript NameFunction/comments
g18566.t1hypothetical protein

Sequence
2539 bases(100 bases per row)
GAGTTGTTGACTCCTCGAGTCGTCGCGATGAAGGGTCGGTCACCCCTGTCCGCGCAACCTCGGCGTGGGCTTCGGCCTTACGCATAAGCTCCGAAAAGTG
GAGCCAGCCGCCTTTGGGTTGGACGAAACCCCACAGGGCATTGTCAATCATTCGTTGGTAAATCATCGGTGCATTCTTCAATCCAAACGGCATACGAAGC
CATTCGAAATGTCCGAGTGCACAGACGAATGCCGAGACTTTGCGGGCCCGCATCGTCATCATAATAGCCCAGAATCCACTGGCCGCATCAAGTGAGCAGA
ACCATAGGTAGGCTTCCAGGTCGGTCAACAAGTCGTCGACTAACGGCATGGCGTACTCCATAATCGCCGTCACTGCATTCACCAGCTTGTAGTCGATGCA
CAACCGAATATCAACTCCATTCTTCTTGAGCACGATCACGATGGGCGACGCCCATGGGCTGTCCGAAAATGCCACTAGACGAGCTTTCAGCAAGCTTTTC
AGAAGCTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTTCTCCGAGCTCTCTGTTTGATGGGTGGATGCCCCTGTACGTCAATATCGCACACCACACCGT
AGGCCGGTGGTGGCAGAGCATTCCCACTCGCAATCATGATCTTCTCGTGTCGTTTCAGCACCGCAACGAGACTTTCTTGTTGACGGGCTGTCGCTCTCGG
GTTCAGAACATTCGGTCCTGAATAATCCAGTACCGTTTCCGAGGCTTCGGTCAGGTCCGGTAAGAACGCCAACTCGTGTGCATAGTCCGTCAACTCGATC
TCATTCGCTAAATGTTCGGACGTATTGGTATCGGTGTTCCCACTACCTGAACCGTCCCCCGCGGCAATCTCATGCATCATTGCTACGAAGGCAGAGTCCA
ATCGGGTCTCCGGGTCATCACCGAGGACTGGGATGGAGTTCTCTTCACTCGTATACGTGGTATCCGCGCCATCAGAGGTGTCGGTCGCCACCGAGTCGTC
ATCTTCGTCGACCCATCTATCTCCAACAGGTTCGTCAGAGGGTTGCACCGAAGTCGTCAACGGCGTTCGGTCTCGTTCTGCCGGTTCCTCAGTGCCCCTA
TTCGCGAACGTTATCTGGCCCTCGTCTAGGCCTTCCAAGTCGTCGGGTGGTCGAGGTAGGATGCCGCGAGGTGTCGGATAGTCTCGTCGTTCTACAGCTG
GTGGCTGATCTGCCAACCATCGTTCGTAGAGTTTGCGTTCCTGCGCGAACAAAGTCTCGTCTCGACACTCCGCATACGCCAGGACTTGCCACTCCTCATA
CTTAGCGGAGTTCAAACGAGTGTATCCATCCCCTTGCGGCAGGTCACCCTTTTTCACCCACAGCAGTACCGATTCGTGTCTCGCGCAGTGAGCAATCTTC
GGCGACACGTTCGTTAGTCGCACCATCGTCGGCTGCCCTCGTCGAGACCTCGTTACAGTGGGCACCAGGTTTCCAATCCGGCGTGCCCACACGTCGTGAG
TAGTCAGAGGCGGCCGTCGTCGTGGTAACCTAAATTCTCGCCACTCACGCCCTGGGACCGACAAATCTTCGGTCGGGCGTCCAGTCACTTGCATGCTGTA
CGGCTCGGCCTCTGCTGGGTTCTGCGACTTCACCAGGGGCACCATTACCTCGTCCGGTAGTCTCGCAGTACCGTGGAACAGATCCAACCGGACTCCGGCT
GGAATCATGAAGTCCGTTCCCAGGACCACGTCCACTCCTGCACTGTGATCCATAACCCATACTTCAAATTCGTACACGCGCTCCCAGCCTAGCGTGACTT
TAACGAGTGCTCGTCTGCGGGTCTCCATCACCCCTGGGTTAATTCCTCGCACTTCCAGACTCCTACCGTGATCTGGAACTTCGCGCAAGCGCAACCGTTT
CGCGTATGACGCGGAAATCACACTGACATTCGCTCCAGTGTCCAGCAGAATCCTCGTTCGCGAGTCGTTTACAGTCCCATTGACGAGGGCTCGCAATCGC
TTCCTCTTGTCATAGCGCTGGGATGACCACCACCCCATTCTCTCGCCAGATAACAGTTTAATCGTCTGGCCGAGGTTTCGGGATGGATGGTCGATTTTGG
CCATGCTGAGGATCGAAGCATCGGTTAGCTCCACTCCGTCTCCGTCCACACGTCGTCCATTCACTTCACTCTCACCGAGGCTTACGCCTCTCTCCTTTAC
ATTTTCCGTCGTTTTCACATATTCCATGTTCAAGTCATCAGGCCGTTTGCTCACACCTGCGAATGCGAACATATAGTCCGCATCCAGCGCAGGTTTGGCT
AACTGTGGCAGCCCGATTGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGACTCCCATAGACGAGTTCCTGCAATTCCGGCGAGAGGTC
CTTCTTCTCGACCTTAGCTCGGAGGAGATTCGTGAGTTCTTGGAAGGCTTCACACTTCCCGGCATCATGAACCTGTTTGCACATCTTGCATCGCTTAAAG
CAGTAGTGAGCTGAATGGGTGAGTCCTCCACAGGCGGCG