Description :
From Genome Similarity Track
Location :
Scaffold_103:75611- 82166
Transcript NameFunction/comments
Physo_141758hypothetical protein
Physo_141759alpha/beta hydrolase fold

Sequence
6555 bases(100 bases per row)
CTGATTCCCAACGCGGCGATGTGAGTCTTGGTTGCGGGCTGACGCAGCTACAACTCCGAGCGCAAAAAGCTGGCTGGGTGTCTCTGAATGCGGCAGCGCC
AGCGAGGAAGTGCGGGCATCCAGCTCCGTTTGAGTGGTGGAGTAGTGGGCGGTGTCGCATACACAGTCTGGGCAAGAGCAACATCGGAGGCAGGTATGTC
CAAACTGGCAGCAGCCAGCACGAGGTCGCCAAAGGCTGACGGGAACGGAGGCGCAGCTCTCGAAGCGTCATCGGCAGCTTGGTCCATCTTGCCACGCGTC
CGGTGTCTCGGGCACAGTGTTCCCGGCCGACGAAGAACAGCAAAGCAAGGAGAAGGAGAGCGAGTCGCACTGTGATTGGCTAATTTTACCTAGATGCGCT
CTGTTGTAGCGAACAAGCTGGAGATGGAGATGCACCAACTCCCTGCAGATATCCATCTCTAGCTGCGTAGTGAACACGCTCTTATCCTAAGACGTAACAG
GGTCTTTGAGACCACAATTTTACAGTTGAGACCTGCGCAGACCGACTTACTTCCAGCGGTGAGTTCTAAAGCGAGTCTTATAAGTCCATTCCCGCATGTG
AAAATTGCATTCAGTCTTGGTGCAATCGTTTAAATACGGCGACTCTTCAGTTTTGTATGGGTGGCATTAAGATTGTGGTCTTATTTTAAGCCTCGAAAGC
CAATCTATAGGTCCCGGTGAACCTGCAATAGGACCTTCTGGTGGAAGCCTTGAGTCTCGGCCAAGTCTTAACATCGTTACTTTTAGGATAAAACCGTGTT
TGAGACCAACCGCTGGAGATGCTCTTACTGACTTATGGAAATTCCTCTTAACTTAAAGTCAGGCTGTGAGATATGATCACCGGGAAGGATTTGCTCGTTG
GTTTAGAGCCCTTAATCGCATGCCAAAGTTCGTGCAAAGCACAATAAAAAAACATTATACCTCCCACTGAAGTTACTGTCCCTCCCAAGAGGTCATCGCA
GACGTGGGATTTAAGAACCCTGCTGCCCCGAGATGACCATCGCATGAGAGCTTGCTCACTGTCCGGAGACCGCACCATTGTGGTGCTGCCTCGTTCTCCC
ACTCGAACCACGCCGCACCCCGCCTGGTGGACGAAAATGATCGGCCCCGCCATCAACGCGTCCAACTTCTGCGTCATTTGCCCGTGCAAGTCCCTTCGGC
GTCACGTCGCCGCTGTCGGCGCAAGGAGGTCTTGTTCCCACAGCTCATGCCCTCCGACACGGCACGCTGCCAGGCCAAGATATTGGGCGACCTGAGAATT
GGCAGCGCTAACACTGTCGTCGGCGCCAGCATTGGCGGCATCCAGGCGCTCGAGTTCGTCGCCAAGTTCCCGAACCGCCTCAACCGCCTGGTGGGGCTCC
CGTCGTCTGCTATCCTCGCCGATTCCATCTACAAGGACGGCAGCTGCACCACCGGCGTGCCTCTTGACTCACTGCCCTCGAGGGTTTGGGGGGCATGGAG
GTGGCGCGCGACCAGAGCATGATCATCATGCCATGGCATGATGTGCTACAGGTTGTGCGGGGAGTTCGGCACCTGCTATCTTTCAAGGCGGCAAGATTCA
TGGCCGAGAGCTTCATGGACTACCAGGCCGATCAGATTGCATGCCTGTACGATCTCAACTACTACATGTACCTGCTGATCACCATGACCACGCTGGACCG
TAACTCACTCAACTTGGCGGAGGGCACGCGCTGCATCTCGTGCCACTCGCTGATCATCGCCATCATGCAGGACCTGCTAGCAGCGCATCTTGGTTCCTGC
AACCGTAGTGCCACAACGCGCAGCTCGTGGAAGTGGAATCCAAGCTCGGCCGCAACGCCATGTTGAACGGCCAGATGCAGCGCGATGTTGCTGCTCGCTA
ACCGTTACAGCAGCTTTGAAGTGTTCTCGATGGGTGCTAAGCTATTCAGCTGCACTTTGTTCACATGTCTGCTATTGGCACTAAGTGGACACTTGAAGTC
ATGCTTTCAATCGTCCATATTTCTGCTTAGTGATTGTTGCTTGTTGTCTGGGAGCTGCGCTTTCGGTGTTGAACTGGCAGCTTGGCAAATACGGGAACCT
CGTCACTAGTGTACTTTCAGAGGGGCGGCGCCGCCCGACACATCGTCTCAATCAATTCTTCAGCGATTTCATCAGCGTACTGGCAAATGGCGCCGTGGCC
ACCGACTTCGAAGAAGAGCGTGTGCACGTGGTCGCCGTTTAGATGCTCCCTGAGCACGATGGACTCTTCGGGAGGGATGACGTCGTCCAGCATGGCGCTG
ACGATCAGAATGGGGAAGCCGGCCTCGTTCATGTCCTGTAGCCGCTCGTCCGACACAAAATGCGTCTGTACTGCGGCGGTCTGGCCGATGACGCCGCTGA
GACTCGGCTCCGGCCACCGCTTCAACTGTAGCTCATACATTCGCGCGATTGCGTTGCGCACGGCGTCTCCCGTCTCCGCTATCCTCGTCTTAGCCAGATA
CTCCTGCGGGAAGAGCGTGTCGACCATGTTGTTGGCCTTGGCCGGCACCGTAAGCGAGAAGGTCTTGCGCACCATCAAGCCGAGCGACCGCCCGCTGGCC
TTGTACCTATCGCGGCTAGTGGAAACGAGCGTCAGCGAGCGCACTCGTCGGAGATCAAGCAGCGCGAGCTCCTGAGCGATCATGCCGCCCATGCTGCAGT
ACCAGCACCAATATACCAAGTCAGTATTATACCAACATCAAGAGGCTATGGTTGCATTGACGACGCACCTGCCGCCGACGATGTGAGCGGAGCGCCAGCC
GATGTGGTCCATCAGCGCGAGGATGTCCTCGGCCATGGTGCGCGTCGAGTACATGCCGAAGGGCGCGTCGGTGCCGCCGAAGCCGCGGTTGTCCAGCACG
AGGATGCTCAGCCCCACGCCGCGCTGCTTCTGGTTCCACTTGGGCAACAGCGAGTCGATGAAGTGCGCCCACGTGTCCTTGGGCTGCATGAAGCCGGCGA
TGAGCACCACCTGTTCCACGCCCACCGCCGCGTTCATTGGCGGCCGCTCCAGCACGGCGTAGCTCACGGTGATGCCCGTGGCGATGAACGCCTCCTTGGC
CGTCCCCTCCACGAAATACTTGGGCGCCGCGTACAGCGCGTCCACTTGGCGCTGGGTGCAGATGCCCGGCGCGGACACCACCTCGGGCTCGAACGGCATC
GCGGTCAATAGGATAGGAGGCAGGCAGGCAGGAGCTCGTTGTTGCCTTTCGGGGCAAATCGAAAAGTGACTGCGCATACAGGCCAATCGAGTCCTGCTCG
GCACCGTCTATGCGAGGCAAGCGCGCGTGTGCTAACGACGAACGAGGTGCGCCGGCGCGAACAAGCCCTGATAACGTCTGGACGTTTGCGCACACTGGTC
CTCGGGCGCACTTCTCGAATCTCGACAAGGTGCCGGGCGTGTAAGCTTACTCGATATCCTTCATTGGCCTGTTTACTTACGGGAGGCCGCGTTCCAGGTT
TTTGGAAACAAGAGAAGAAGAAGTTGCGTCCCTGGTGAACCGGTCTGATTGTCTTTAAGGGACAGAAGCGCTGTGAGCGTCGGCGGGTTTCGGCGCGGGG
GGCAGCTCACCGCTTCGTCAACTCCCAAGGTCGAACAGTGGGCGACGTCAGCGACTTTTGCGGAGTTGTGAGCGAAAAGCCCCGAGAGCTCGAGAGGTGG
CGTTGTTTTTGAGCTTACGATTGGTGTTGCCGCTGGCGCAGATACGACTACCGCGAAGAACCCCAGTGAGGATCGACTACCCGAAGATTGCTGGTGAATT
GCATTAAGTAGCTACATGTAGTTCTATTCTCGCCGCTTTCGAAGTAATAAATTTTGAAACAACCTTGCTTTCCTCCGAAGGCAAGGGTCGTGGAACCTGC
CTTGGCTACGCGTTCCAGTCGTTCGTCCGACAAGTACAGTAGTTTGTCTAGCATGCTTCGCACCGTGCGCTACCGTGGTATCCAATGGAGGATACGTGAA
CTTCGACAGCTCCGCTCACACTCGGTTCGAAGTGTTGCAGGTGCTGAACGACGGTTTGCTTGTTATTCGTCGGGACTACAGCAGCCCAAGCGACCCTCAC
CTCGTCCAGATCATGTTTCGACCGCAGACTCCGAGAGGATACGCCTTCGCTTTTGCTGCCCCTTTGTCGCTTCTTACCGTTTTTTTCTGTGGTATCCAGG
ATGAATTTCAATCATTTATACGACGAATACGATAACTCGGCAGGTTGCGAGGTCGTGTACGGGGGTTGTTTCGACGATCAAGACCAGCTTAAAGCCAGGC
ACTGGCTGTTCAAGATGGTTCGCAGCATATTTCAATGGGAAAAACGCCACCATTGCTCCCCTCGTTCTTTTTGCAGTCATGAGGCCACCCTGTCGTTTGG
CTGGGTTGCTGTAAGATGTCAAAACCAAGATTTCATGATGCCCACCTTTAGTACTCGGAGGTAGTTGTTTTGGTGCTGACACTTCGCGTGGAAATTGACG
GGGGTTAGTTTGGATGAGTTATAACGATGAGTTTTCCCGGGAACCAGCTCAGCAAGCAACATGAACTCCAATCCATGTCACGGCGAACCGTCTTATTCTT
CGACTGCGGATGCTGGGTGATCTCAAAGAAACCATTGCAAACATTTGGCGCATACTAAAATAGCAGGCAACTGCCATTGAGATTTTGTGAATCCAGCAAA
CCAGACGAAGATCCACGCTAACATGGTGAATCTTCGTTAGCTCCTCGGCATCCCTCGGGGTTGGATGCTCATTTCGCTGCGATTAATCAGCGTGACACCA
CCGAGTACGGACGTTGCAGCGATAATACTTCCTACGATATAGCAACAATATAGGCGCGTAGCGAAAATACTGTGGCATCCAGTTTCGGACCAGTCTTAGT
TTGGAGTCGCAACGTTAGCAAATGGCTGAAGCGAAACGCCCAGCATGACCCGCTTCCAGCAAGCCCCCTTCCGGATCAATAGATAAAATAATTTAACGGA
TTCTTATATGCAGTGTGTTTGTGGGGGGGCGAGCCTTTAGCTCTTCTATGATGCGCCTTGGAGTATGGCGCTGTGGGCTAACCTTCCGCTGGGGACTCGT
ACAAAACTCCCAAAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN