Description :
From Genome Similarity Track
Location :
Scaffold_664:7560- 12592
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_664-snap-gene-0.6Protein phosphatase 2C
Pytiw_DAOMBR242034maker-piw_contig_664-snap-gene-0.93'5'-cyclic nucleotide phosphodiesterase

Sequence
5032 bases(100 bases per row)
CGATTCGCCAGGCTCTCTTTATCAGTGGCATCGGCTTGTCCGTACTCGCCATCGCGCATGGAGACACCGGCAGCGCCTCTGTGTCCTCAGCAGCGCAGTG
CGATGCGAGGTACACGCCCTCGTACAGCGGCGACCCGGACCTCGACCTCGGCGGCTTCACGCTGCCGCTCGACGGCGAGCGCTTCGAGAAGCTTGAGAAG
TCGCTCGCGAAGCGCTTCAGCTGCGCGACGTACAAGGCGAACGCACCGATCGAAGACCGCTTCGACGTCCAGTCCACTGCGAACGGAGATGTGTACGCTG
CGGTGTTTGACGGACATGGTACGTTTTGTGTGTGTGTGTGTTGCTTTAAGTGCTGCGACTGCTAGTATGGTGTCATATATATATTTGCTGACGTTGTGAA
CCTTTGTGAACCGTTAGGCGGCTGGCAGGTGTCCGAGTACGTGAGCAAGACGCTCATCGGCAACATTCAGGAGGAGCTCAAGCACGCGTTCAAGGACCCC
GAGCGCGAACAGGAGAAGCCAGCGTCGCCCAAGAAAGTCGCAGCTGCAATCCAGCGAGCGTTTGGACGCACGGATCGCGAGCTCATGGCGCAAGTGCTGC
CTGCGTTCAAGCTGGGCTTTGGTGCTCTCGCGCGCTGCGGATCATGTGCGCTCTTCACGCTCGTGCACGAAGACTACCTCCATGTCGCCAACGGTACGTG
CTTTACTATACATCTTAGCTTGTTGAGCTTTACCATTTACTTATCGGCGCTGTGTACGATGCACGTCAATGATCTTAATGTAGCTGGCGATATCCGTGCG
GTCCTGGGCAAGAGCGACCCATCGAACAAGGACAAGATGATCGCCGTGCCACTTAGCAACGACCAGAACGCGATGGTCAAGTCGGAGCAGGAGAAACTCA
AGAAGGAGCACCCGGGTGAAGCCAACTCCTTCACGTGCCGCCACCCGGACTCGTGCTACGTCAAGGGCGCGCTGCAGCCGACGCGCGCGTTCGGTGACTT
TTCGCTCAAGTACACCGAATTTAACGGTCCACCGTACGTGAACGGTGATCGCTCAGCGGGGCGCCACTTCGTCGAGCCGTTCTCGCCGCCGTACATCACC
GCGATCCCCGAGATCAAGAGCTTCAAGATCGACCAGAAGAACGACCGATTCGTGATCATTGGCTCGGACGGGCTCTGGGATTTCCTGGGTAACGAGGAAG
CCGTGGAGGTTGTACGTGAGCAGGTCGCTCTGGGCAACTACGACCACGCGGGCCGAGCGCTTGTTGAACGAACGCTGCAGAAGGCCGCCAAGCGCTACGA
GATCACGTACGCGGACCTCCTGAGTTTGCCGCCTGGAAGCCACCGCCGTCGCCGTCACGACGACACCACCGTCGTTGTGCTCTTCTTTGACTAAGTTTTC
GACTGAGATGGGTAGATCGATGACAAAGTCTACCGGTATGGCCAGCTGGCGAAGATGGCGAGCGCCGTGATCAGGAACTGGTTTGCTGTGAGCAGAAACG
ATGAACACAGTAACTACAGTGGTGAACCGTAAACCAAGGTAAACCATTTTCCATTCACCAACCGCCTGCTTTTGTGCTGTGGCTGTGGGTTGTTATTACG
ACACGGTTGTTCTCACTAATAATCACATTGAAAGACAGGAACTCAGCAATGCTAGTCACCCGTTACGAAGGACCGACCTGGTGGCATCGCTGCAGCCCCC
GCCGCGTGCAGTGGAGCCAGCGGGTGCAACGCTCCTGCAGCTGCAGTCTGCTGCTGCTTGGCTGCCTCGCTCTCGCGCTCGATCTCCTCGTCCAGCTGCT
GGCGATACAGGTCAAAGTTGAGCTCCAGCGAGTCCGTGTAGAACTGCACCAGCAGCAACAAGTCAGTACCAGCCACAAGACCACGACACAAGAATAAGCA
ACACGTACGCGTAGGTGGTGGCAGAGCGACGTGAGCGGCAGCCAGATGGGGCGCACGACGTAGTTGATGTAGTTGAGCTGCACGATGAGACGCGTGCGCC
TACTCTCAAGGCCGTGCATGAAGAAGTCGGTGGCCACGCCCTGCTCGGCCTCGGCGCGCGCCTGGTTCTGGAACTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCGCCCCAGTCGCAGGACTGCGCGAAGGGTAGC
GTCTGGTGTGACAGGTCGGCCGCGTGCACGAGGATGCCCATGAGCAGCTGGCTCTTGTCATGGAGCTGCCTGCGCGAGAGGCTCTCGAGCGCCTTGCACT
TGTCAAAGTGCCTGGCCATGTCAGTGGCGAGGATACAGCTGATGAGCAGCTGCCGCACGCGCTTGTAGCGCGCGTCGTCGAGGTGCTGCAGGATCTTGGC
CGACTTGTGGTTGAGGATGATGAACGTCACGCGGCAGTGATGGCGCTCGAGCACGGCGTCGTCGTTGTGCGTGAGTGCCAGGGGACTGAGCGTCTTGAGC
TCAAAGTCGTTCGTGTTGCCCGGGTGGTCGATGTCGTGACACAGCGCCGCGAGCAGCATGGCGAAGATCTCGACGCCGCTGAAGAACTTGCGGCACTCGG
CGCGCAGCATCGTGTGCAGCGCAAGCAGCACCTGAAACGCGTGTTGCAGGTTGTGGAACGGGTTGCCGCGGTAGTAGTTGGCCACGTTGGTCGTGAAGGC
CGAGAACTTCTCGCCCGAGATGCGGAAGGCCTCGAGGAAGCCGTAGGCGCGGAACACGACGCTGCAGAGCTGCCCGATGTCACCGCTTGAGAGCGCCAGC
GTGTCCATGTCCCACTGCTCGAGCGGCTCATCCGCGCCGCGGGCGAACACGATCTCACGCGGGAATGGCACCTCGTCGTCCTCGTGCTTCTTGCGCAAGA
GCGCCGGGATCACGGATGTCAGTGACGCCGGCTCGTGGGCTCCTGTGAGGCTATGAGAGCCATATGGAGCGCCAGCATCGCCAGACCCCGCCGTCTGCTT
GGGAGGGCCCGAGTTGCAGTACTTGTTGACAATGGACGAGATGATGTCCGTTTCCGAGTACTGGTCTATGCGCAGCATCGACGACATTCGGCGGATTCCG
GGACTGGGCGACGCGCGGCCGGCGCCAGGCGGTCCAAGTCCAGCAGCGCCAGTCGAGGAGGACGCCACGGCTGTGGTGCAATCCGAGACGACCTTGTAGT
ACGAGATGTCGAGAGAGAGCCGACCGAGCGCGAACTGCACCTCGCGCGCGTACTTGTCCATGACCTCGCGGTCCGTCTTGGTGAACGCCACGACGTGCGA
GCCCTCCTTCTTGTTGATGCACATGGCCACGGCCACGCACTTTGGGTTGGCGACCGAGTGGTTCTCGAAGACTGGCGCGCAGAGCACGCTCGTGGTGCGG
TAGCCCGTCTTGGCGTCCACGCTCGGGTCGAAGAGCTCGTGCTTGTACGCGTCGCGCGTGCACACGGTCTTGCCCGTCGTGGCCACGAGCCCCGAGATGC
CGCGGTTCATGGGCGTGCGGATGCTCTCACCCCCGCCCACGTGCGGCGTGATCCAGAGCTCCTTCTTGAAGTGGTCGATGAGCAGGAAACCGAAGCGGTC
GCACTCCATGATGTCCTGGCCGATCTCCATGACCAGGTCCACAAACTCCTCGATGTCGGCGCTCTCGGACACGAACGTCGTGAGCCGCAGGCGCGCCTCG
ATGAGCTTCTGTGACGTCTTGACCTCGTGGTGTAGGCTCGACTTGTGCAGCGAGATGCCCACGGCGTCGGCCGCGTAGTTGAGGAAGATGGCGTCCTCGC
TTGTGAAGTCCGTGCTGTCGACCTTGTTGACCGCTGAGAGCACTGCGAGGATGTGACCCTCGGGGCTGCGCACGGGCAGGCACAGGATGCGCTTTGTGAC
GAAGCCCGTCTTCTGGTCCAGCGTCGGGTCGAAGAGCGGGTGCGCGTACGCGTCGTTCGTGATCACGGTCTCGCCCGTGCGCGCCACGTAGCCCACGACG
CCCTTAGTGATCGGCACGTAGTCGCCGCGCACAATGTCGGCCGCGCACGCGATGTAGAGCTCGTCCTCGCCGTCGATCTTCATGAAGAGCCCGATGCGCT
CGGTGCCGAGCAGCTCGTGGCACACGGAGAGCACTTGGTCCAGTACGGCTGACGACACGGCCTCCATCGAGATGTTGCGGTGCAGCTTGAGCAGTCCTTC
GATGCGGTTCTGCGCCGTCTGCCGCTCGCGCACGAGGATGAGGTTCCAGATCGCCGAGCCCGCGACAACTGCGAGGAACTCGAGGCTTCGTTTGTCTGCG
TCGGTGAACGACCGCGCCGGTGACGACGCGAGGGAATGCATTATGCTGCTGGCGTTGTCGTTGCAGTGGCTCTCGTCTGCAGTGTTGTTACTGCCAGCAC
AGTTGCTGCCAGACATAATGGACACGACCTGGAAGACACCGACGACGGCGTGGTGCGCATTTCGGATGGGCAGACATAAGAGCGCGTGCGGAACGATGCC
GCTCGACTTGAGCTGCTGGTCGTAGTTCTCGTGCGTGTAGAAATCCTCAATGTCCAACGGCTTGCCCGTCATGATCACGCGCGCGAACGTTGTCGTGCTG
TCTGCTGCGACAAACCCCTCGCTCGTGAACGCGACCGCGTGCTTGTTCTTGTTATTGCTGCGGCCAGAAAACATATCGTGCAGCTGAGGTGCTGGTCGTT
TGTTCGTTGGCAAATCGCCCGCATTGTGAAACACGACAGAGAAGATCTCGACGATGTTGCGCCGCTCGTTGAGCAGTCCGAGCGTGTACTTGTTGGCGCG
AACGAGCTTCTGTGCTGCGCCGAGCGTGCGCGAGATCACGTCCGTGAAGTCACCTTGTGCTGAGATCTCCTTCACTGACGCGACGACATCCTCGAGCTGG
TTGACGCGCTCCTTCACGATCATGACTCGCCC