Description :
From Genome Similarity Track
Location :
Scaffold_902:7560- 9221
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_902-fgenesh-gene-0.1Folate-Biopterin Transporter (FBT) Family

Sequence
1661 bases(100 bases per row)
AAGCTCGAGATCGCCGAGCGCGGCTCGCTGCCGAGCTCGGTGAAAGTGGGTGACGTGTACAATGACATGCTGCAGTCTCCGACCATGGGGTTGGACCGCT
ACTCAGGCAGCGAAGGAAGCCTACGCAGCGGAGAGGTGCCGAGCCTCTTGTCCAAGGAGATGTGCGGGCTGTTGGCGCAGTATGCGGCCGTCGGGCTCAT
GATGGGTACGCTGCCGAGCACCGTCACGCCGTTCCTGAGTTACTATCTCAACATGGAAGGCCAGGCCACGACGTCGGCGCGCGCGCTGTTGGGGATCCCG
TGGTCGCTCAAGGTCTTCATTGGAGTCTGTTCGGACTGCTTCCCGATCTGCGGCAAACGCCGTCGGTCCTACATGCTGCTCGGCTGGATTATCTGCGCTG
CTTGCCTGCTCGTGATGGCCTTCACTCCCGTCAGCCGCCCGTACTTTCCCGACGCGTCCTGGAGGAACCTCAAGCCGAAAGATTACACGATCGAGGAGGT
CAGAGCCATCAACCACGACGCGCCGGGCCACGGCGGCAAGTACATTGTGCTCATGATGCTGGCGACGCTGGGCTACCTCACCTCGGACGTGGCGGCCGAC
GGACTGGTCGTAGAATATGCGCAGCGCGAGCCGCTGGCCGTCCGCGGGAGGACTCAAACAGCCATCTACACGGTGCGCACCATGTTCAGCGCTCTCGGTA
GTCTGCTGGTCGGCATCGGGCTCAGCTCGCCACCCTACGGCGGCAGCTTCGACTTTGGTCTCTCGTTCCCAGCCTGCATGCTCATCCTGGCCGTCTGCTG
CCTCCCCGTCATGCTCGTGACTTGGCTGTTCGTCTGCGAGACACCCTTCACGCCGCCCAAGCTTGGAGCCTATCTCGGCTCGCTCTGGCTCGCTGTGCAG
ACGCGTGTGGTGTATCAAGTGATCGCCTACAGCTTCTTCTCCGGTGTGCTTGGTGGTATCGGCTACGTGACCGTGGAACCCGTGACCATGTACTGGGCAC
GAGCATCGAGTTTCAACATTGCCATCGCGCAGATCCTGGCGTCGGCCATCACGGTCGTCTCGTTCGTCTTCATGGGTCATTTCGGGTTGCTGTGGAACTG
GCGGACGGTCACGGCGTGGACAACGGTAGCCGTCGTCATCCTAGATGCGGTCTGCACGCTACCGACCGTGTGGAACTTGGTCCGCAGCCAATGGTTCTGG
CTCGGACTGCCGATCGTCGAGGCAGTGCCACAAGCCATCAACTTCATCGTGGCAACATACGTCGTGGTTGAGCTGGCTGGAGAGGGCACGGAGGCCGCCA
TCTACGGTCTCATGACGACGGTCGGGAACCTCAGTGCGCCATTCTCGGCCACACTCACCAAGCTCATCGACGGTCTCTTTCGCGTGAGCAACACCGACGT
CCAGAACGACAGCGCGGCCGCGCGGCGCGACGTGACCGCCACGGTGCTTATTTCGTACGGCTGCAAACTCGCGGCTCTAGCGTTCCTCGTTTGGCTGCCG
AGACAGAAAGTCGAGACGCAGGAGCTCAAGAAGGCTGGCGGCGTCAGCAAACGCCTTGGCACGCTCACGCTCGCGTATCTGGCCTTCGCGCTCGTCTGGT
CGATCCTCGTCAACGTGCTCGGCATCTTTGACCGCACGCGATGCTTACCTGTCACAGGTGG