Description :
From Genome Similarity Track
Location :
Scaffold_722:7558- 10760
Sequence
3202 bases(100 bases per row)
TCAAAAAAAAAAGTACGAACCAGTATGAAGTCGAAGCAATTCTCGACGATGAGCTACCATTATCCACGAGTACGTCACGATTACAACGGAAGTTTAAAGT
TAAGTGGGTCGGCTACGATGAGCCTACTTGGGAACCACTGTCGAATTTGTCATGTGGAGGTCTCCTGTTTGACTATCTACGACAGAAGAAGCGTGAAAAC
CGTCTGCAAATGGTGCAAGTTGCAGATGAGGATTAACAGCTATTGCACCAAAAGTTACACCAACGCAGCGGACGACACAGGTCGAGTTGAGATGGAATGC
TACTGTGTCGAAACTACATTTACTGAATAATTACGAAATGAAGTCCTGAACGATACCTACGGGACGCCCAGTCAAAAGAAGAAAACTAAAAAGTTGGCGA
TCCGGACTCCAAGTGAGTTGAACCCGACGGAGACAACTGGGAAGAGCTCAGCGGACTCGACGATTGGAGGCGTGGCGTCGTAGCAGACGTCATCCCTTGG
GAAACTGCGGGAGGAGATGCAACATCCGCAGCCGTGGCAAGAAGTATTATCGCCGAGCTAGCCAACGGAGCTGAAGCCGAACCAGATGCCTCAGGACCCG
ACTCGGCTGAAGTGGGTTGAGGCGGATCCGTTCCACTGGGGAGTGGGGTGCCGAACAGAGACATACTCGGAGATTGGGAGAACTCAACCCATCGTCCGCC
GAGTCGTCATCAGACGCACTCTCGTCATCTGAGCCGAGCTCACCGATTGAAGACCCAGTGAAGATATGGATGCCTTGACGATTCAGCCGAGTTGGAGCAC
CCGGGGCATAGGCAGGAGGCGCTTGTTCGGCAAGATCAAAGTCTTCTTCCATCGCGTCGTCAACAACCTGAGGATCCATACCGCGCGGAGCGAAAACCAA
GAAGTCCACGTTTCGAGCGCGGAAGCAGGTGTTATACGGGTGGACCGCCGGGTCAGTTAGCCACCAAGCCCGCCAGGGCTCGGCTAGATCCACATCGTGA
GCACATTGGACCCAGTCTCTCCCGGATGGAACCCACGAAAGGTTAACAGGAGAATAATGGGGGACGGACGGGTCGAAATAAACCTCTGCGTCCACCAGAG
GAGCAGATTCATCGCCGAGTTTCTGAGTGACCGCCGAGTAAAGCTGATCGTAGACAGCGACAACCAAAGATCGCAGAGTGTCATTACGACGCTTGCGTTC
ACGCTTGTACACCAGCCACAGCTCATACACCTCAGCAAGCTGAGCGGGCGTGGCAGCCGGGTTGACGTCAGGATGGAGACCCATCAACACACTCGACTCG
ACGATCCAATGACGGCGCTCATAGAGAGCTACGAAGTAACGGGTGATTTGGCCATCTGTCTGGATGGGCCTCCCCGCCGAGTCCAAGGGACTGTCGCCAC
GAAGCTTCACCCACATATCTCCAAGAACTTGCATCAAAGTTCGAGGTCGGGTCTGAGAAGCCAAACACCGCCGAGCTTCCTCCAGTATCGACGGAGAAAA
GAAGAAAGGAAGCTCAGGGAGCATCCGCCGAGGACGCTGACAAGGATGGCTCGGGTCGAAAACGGCCATGAAATCTCGAATGCCGTCAAGAGAACACGGC
GTAGGTGGCACACGACTCTTGCCTCCTACGAGCTCCATCTGCACCCCTCCGCTCAGTGTATCCAATAATGCATTCCAACAACGGGCTGAGCCGAGATGCA
TGAATGGTACGTCGCGGAGTTGAGCCATGTGAAGAGTCAAGCGACAATCCTTGGACACCGCTTGCGAGGCTCGAGTCCGTAACGTCGCCAGCGGGAGTGT
AAGAGCGCTGGGTAGTGCGACCAAAGCCGGACGTGAAGCAGTCGAACTCGGCTGAGAGAGAATCGATACAACCGGGAGCCTACTCGGCGAAGGAGCAGCT
GGAATGGATTGAGCCGGAGCTAGATCAGGAGTCAACGGAAGCTGTCGATGCTTGTGAGGTCGGTGCGTCTTGTGATGCTTCTTGTGTTTCTTGTGCTTCT
TGGATCGCTTCGACCGATGACCAGTAGGACTCGACGAGGCACGACGTTTGCGATGCTGCTGCTTCCCCGAAGCCGGCGCAGAGGCAGAACTCGTCCCGTC
ACCAGAATCCTTCGATGAAGGCCGCGAGGAGTGGCGATCACTCGGCGGCAAGGACTCATCACTCATCTCGTCGTCAGAGCCGAAGATTGCCGCATGAAGG
CTCCTTGCTTTGGCAGAACGACGAGCATCTTCGGCCGCTGAGTCAGAAACTGAGGGACTGCCAGCCGAGTTCTCGGATAAAGAAATGGGATCCGAGAACG
ACCCAGCGGCAGGATTCGTCGAGCCGGTGGACGGTGCAGAACCATCACCAGGCCCTAACACCTCGTCGTCAGATGCGTCGAGGTCCTCAAGCAGCTGAGC
AGTCACAGTGCGGGCGGTCGCAGCAGATCTCCGGATAGGGCGCCCAGATGGGGACGTCAACACGGCCGTGGTCACAGGGAGAGACGGTCTGAGGACACTC
ATGTGGTGAAGTGCTTTTCAGAAATAAGAGAATGGGCCTGACGCGGGGTCACTATCCCGAATCAGTGACAGTTTCAAGTGATTAGAGAGGATTTGGGTTG
GTGGCACGGATGCAAGCTGCCGGTGGTGGATTAGCCATGACGAGCAGCACCCCGTATGGAATGACGATGGATCTGGTATGAGCGATGTACGAGAAGGGCA
AGATCCACCAAGACTTACCTCGGATCCACCCCTTACCTGGATTCACTAAGATGGATATGGGATATACTATACAAGAGTGGATCGAGTGTGGATCCTATGA
AGGAAGGATGGTCGGTGCCCTCTGACGGTGGATCTAGTAGCCACGGCTAATGAAGAGTCAAGATCCACCGCGAGGTACCCCGGATCCCATACTTCTGAGT
TCGTATCCAAGGAGGGAGGATCCCGCCTGGAGGGACCTGGATCCAGGGTATAGGGATGAGGGATACAGTGGATCTCGAACTTTCGTGGGACAACGGAGAT
CACAGACGGTTGCGAGATGATGTTGGATTATTGGAGAGCTCGGATCCACGGCGAGTGTACCATTACAGTGAGGTGGATCCAAGCGACCTGGGATCCGGAA
ATCTTGTAGTCGGTATTTAACAGCGCAAGTGGTCGGAAATTGAGGGCGTTATGAGGGTCACCTCTATTGTTCAGGCAGAAAATGTCTGCGTCGAGAAAAG
AG