Description :
From Genome Similarity Track
Location :
Scaffold_1534:7556- 8585
Transcript NameFunction/comments
Phypl_g13640hypothetical protein

Sequence
1029 bases(100 bases per row)
AGGCAGGTACCCGTGATTCGCAAGGGCGTTGAGTGCTGGGCACGGTGAGCGGTGAAATACAGCGGTGGTGTTGGGCACGCCTGATCCTTTAACGGCGGAC
GGTTTGTAGTATTCTCCAACTTGTAGTTGTTCGATGGTGTGGCAGTACCCCTCGCTTTGCAGAGTTCCTCCCGCTTGGACTGAGGTTATGTCGCTAATAG
CGATGCATGAGATCGCTGCGATGAACGCAGCACGCAACATAATTGGGGGAAGAGGCGGTGTCGAAACAAATTGGCAAATGAACTATAGTATAATAGCAGA
CGCACCGTGCCGTTCTCGATGGTGGCGCCAGCGATGCAGGTAATCTCCGGATTTGTTTGCTGGTGGTCCAGGGCGCTGCAATGCAAGAAAGTTTatcatg
ttgaagtggagtAACAAAAGTAAAGCAGACTATCCACATAGAGCGCGACAAGGCTTCACGCCCGGCACATTATGATcttgcagcaagaacgaTCACACCA
GTTTGGCTTTTCAGACTGAGTCAGTTTTCAGACGGCGGTCCACGCTAAGGCTCACCTATTTTACATTGACCGCGTGCTTACCTTCGCACGTTTCTGATGC
AGTCCTCATACCAACTAGTTGGGGCCACAATGTGCAACGACTACATAACACAATAAGCTAAGAAGAAGCTACACCGAGTACTCGATGCAATAATCGGAGT
GACGACGTGATGCTCAGTGTGCAGTCGTCCGGAATCTTCTCATTGATGGTGAGCAAGCGcgcgtggccgagttcgtgcCACACGTTCCGAGCACCGAGCA
CCAACCCCAACGAACCAGTAGACCAATCTACTTGGGTGACTTCTGCTTGCATGAAAACTCTCGTCGCTCTCAGCGAAATCAGCACACTCTTTCCGTCAGC
AGACATGACAGCACAAGTGAGACGGCAAGAGGTTCTCGACGAAGTATTTAAATATTTTTACTCGGAATAGACATTTATAAAAATATTTTAATGCATTTTT
ATCGTCCATCTCCCCTAAATCCTCACTTC