Description :
From Genome Similarity Track
Location :
Scaffold_64:75555- 77809
Sequence
2254 bases(100 bases per row)
TGCTGTGGCGCCAAGCCTCATTACGAACTCAGTCCAGAAAGACAACAGCTGTGGTGCTGGAATTGGCACGTGAACTCTACTACAAATGTAGTTAGGAAGC
TCCCACAACAATACGTCTGCTAGGATAGCAAACGATCGTTCGGGCGGACCTGAAGACCCCAGTTCTGCCCTTGCACCGGGACAGACTGGACCTTGTAAAC
TACTTATATAGACCAACCAGTAAAAATAAGATTACGCTACTAGCACGAGCAAAGCTAATAGGTGCTTTGAATCCTCGTGATCCCAACAGCGAAAGGGTAC
CAGGCACGAGTAAGCATTTTACGAGGGCCTCGAGTGTTCGACACTCGGTTGGACGAATAAAAGGGATGCAATACAAGCACTCCCAGTCGTGTAAATAGGC
AACAATAAGCCGTCACGTGTAACCTCCAGATAATATTCGGCCAATACACACACAGTCTCTTGGCCTTGCCGGATGAACCCTCGCTACAGAGCTTCGAGTT
CATGGACAGGCATAACACACTCAAACATGCTTAGCCCGACGCTTATCTTGAAGCCGGACGTCGCTATGTGTGCTTGAGTGGAAATTCTGTTCTGTATTTA
TGTTTGCCCTTTCGGGCCTATTCCTAATAAGAAGTCCTAATCAAGTATACAATTATCAAGTGAACTATGATCCGTTATGGATCTTCTTGCACGCCAAGCG
TCGTGCTCACCGTCACATGAGCATCTTTAACAGCTCGTGCCCTGTCCGACACGGTAAACGTGCCTTCAAAGAGTCGCGGAGTTTTCTGCGAGCTCATCTC
AACCGCCACCGAGGGTTCGTACCGTAGATGGTCAGTTCTTGGCCGCTGAATGCGAATCCGGTCAGTCCATTATTATTAATAAGGACAGCCTGGATTCAGT
GACATATGGACCGTATCCAATATCCGTTGAGTGTTCGGTACTGACGCCGTCGAGTCTCTTGCACCTTGGAGTCACCGTACATCACGTGACCGAGGGTTCG
GCGCTTGAACATCCTCGACGGTGCCGCATCTTTGTTGACGGGCGATTATCCGCAACTCTGGAGAAATCACTACACCACAACTGCCCCTGTCGCAATGGAA
GCCACGGTACCGGTGCCCGTTGTGACATTTCTTCATTCTCCAATTCACCATCCAGTCGCAGGATGCCCAAACGTCTCAATCGGGCCGTGAACAACGCGCT
TCAGCGTCTCAATCCGCGCCGACGTTGTGAACGTGAACAGCTGGAGGTACGTCAGCCCATCATCCTCGTCAGTCATCGGTACCTTGCTCATTACCAGGTA
TCCTTTGTCTTGTATCACAGGAGGGCGGCACCGAGGTTTCGAACGCCCCTCAGCCTGCCCCACTTGCTTCGACGGCAGCTTCACCAACTGGAACTCCGGG
ACTTCCTGCTCTGGACCCTTCGCCTCCTGCAGCAGCTCCCGCTGAAGCTGGTGCCGCGGGTTCACAGGCTTCAGATGCGGTTCTAGCCGCCGAGGCTCTG
CTTTCGGACGAAGAGGAGAAGGAGAGTGAGGACTCAACTTCATTGACGCTCTTGGTCGCAGCTGCCAGGCAATTGGAGTCGCTTTGAATCATTGCTACAT
GCCACCACGTTCAGCTAACTGTTGAGGGGCCCAGCGAGGTTTCGTTTTCAGTGGTCGCACTTTTGTCGACGCTCATGACTTCTTATTCTTAATGCACTTC
TAAAGCATAATCATGTTCACGATGTTCTTTAAATGCAAATACAAATTGTTGTTGAAATAGCTTGTTTCGTCTGTTACTACAGGCTGCATCGCCCAGTGGA
CCGTTCACACGTGATCCAGCCACGCTAGTCTTCGTCCGCAACTTGCGCCATCTGCAGCCGGTTCTCCCTTTTCTTGGTTCGCAAATAGTCGTACAGCAGA
CCTCCACACGATAAGTTGGATGCTGGTTCCCAAGTTGGATCTTCGTAGCCAACCCACTTGACTTTGAGCTCGCGTACAGCACGCTCCGTGCTCGTCAACA
GTGGTGTTCTATCGTCGAGAATGGCCTCGACTTCAAACTCGCCAGCAACTTGATCTGGTTCCCAGCTGTCTACAGGCAACAACTCCTCGTCGAAATCGAA
TTTTGATTCATTAGTCGCGTCTGGTACTACACGAGCCTTCGGTCGACTGCTGAATTCGTTTATAGTCTTGAGTCTAGACACATGCACTACTGGGTAAAAG
CGATACCCACTTCGGTCTGGCAGCTCCAGCTCGTACGCAAACTCTTTTACCTTG