Description :
From Genome Similarity Track
Location :
scaffold_6:75545- 111605
Transcript NameFunction/comments
Pl_1127707 transmebrane protein Gpr8
Pl_112771hypothetical protein PITG_03286
Pl_112772hypothetical protein PITG_03285
Pl_112773hypothetical protein PITG_03284
Pl_112774hypothetical protein PHYSODRAFT_309032
Pl_112775conserved hypothetical protein
Pl_112776polymorphic outer membrane protein
Pl_112777hypothetical protein PHYSODRAFT_470730
Pl_112778PREDICTED: hypothetical protein LOC100633501
Pl_112779hypothetical protein PHYSODRAFT_476544
Pl_112780hypothetical protein PITG_03279

Sequence
36060 bases(100 bases per row)
ATGTACAACATGCCACCTCCACCACAAAGCATCAGCTGACTTCAAAACCACGTTGGGCGAACCCACGTCCAGTCTATCGACTGCTGTACCGAAATTCGAG
GAGCAAGAAATATCCGCCCGAATCGCCAAAGCCAGAAATCGGAAAGCTCCTTGATTCTTGGTGACAATAGTCTTTGTCCTTTGCGACTCCAGACGTAACT
ACGTGTTTGCCAAAGCTTTCAAACCCATAACTCACAGCAACATGGCTACATAATAAAAACCGCCTTCTTTAGCCAATCAAATTCTTGCTGGTTTTTGAAG
TTGAATTGCTAGAAGATCGCCAGGTCTGCAGTTCCCAACGAGAGAACAACGATGCGATTCCTGTTAGTGCTCAGCTTTGCTCTTCTTTTGTGCGTCACCC
AAGCCAGTATCTTCGCGGGGTACACTGTGGGGCGGCAGTTCCAATATATCGGCAAGTTCTGTTTCTCTTGGACGGCCACACTCGACGACGTCGCAGGGGT
ACGACGAAACGTTTACGAAATGTATACTAGGATCGCCAATCTGTGCTAACGTTGATTGTTGCCGTCAGCGCATTGTGGGCGAGATTGAGACGGATGTGGA
CGGACTCCAAGTCGCCATCTATGACGATGAAGCGCTCTTCTGGAATTACATTATGACCGAAAATTCCTGCGACTGTTACTGCAAGGTCTCTGCGAAGCAC
ACAAAGGGCGTCTTTAATGTGACAGCCACCAATAGCCATCATGTGACCCCCTTCTCCTTTAGTGTGGACATTCATGAGCATCTACGTCCGAGATTTTGGT
ATGTGGCTCTTGCGCGTTGTGTTCCTGGAGGGGATAAGTATAAACCCTCCTTTGCGGAGATCACCGAGAGCAACTTTCGCAAATACTACTTTACGTCGTG
GTTCAACATTCACATGACACAGGGGGATGGGAGTGAACTTCCCGTCCAGCAACAAGGAATGCCAACTATTTACGCAGTCATGACGACAGTGGCTGGGGCT
GCAAGTGTGGCACAAATTGTGGCAGTGCGTGGCATGAGGAGTGAATCTTTTCACCCGATCATGAGAATTCTTACGCTAGTGGTATTGTTTTTCTTCTTGT
TCAACGCGTTGCTCTTCATCCACTTTACCATATACCAATCCAATGGTTTGGGGGTACCGTTCTTCAAGTATGCAGCCAAGATCACAGAGGTGTTTGTTCG
AGTGGGAACTTTGCTGTTGGCGATGCTGATCGCGAAAGGCTGGACGATCAACAGTGTGACACTGGACGGACAAATCAAGCTTTCGTGTGTCATTCTTGTC
ATTCTTGTGCTTTACCTGTCCATGGCGATGTGGTATCTAGTATGGCTTGACCCAGCATCGACGCTGTACATTTACGACTCGTGGCCGGGGCTCGGAATCT
GTATCTTACAGGTGTGTGTGCTTGGGTGGTTCATCAATACTATCCTGGAGACACGCTCTTACGAGAAAAGCTCGATAAAGCGACACTTCTTTCTGCGAGT
AAGTGTTAAAATTGTTGTGCCAGACAAGTGTTTTGCTCACCCCAGCTTCAGATGTGCTGCTTATTCTCAGTGTTTTTCGTAGCTTTGCCTGTCATCGTGC
TTATCGCGTCGTTCTTGTCACCGTGGGTACGCGAGAAGACAGTTGCTGCCATGACAACCTCAGTGTATTGCTTTATCTACTTGACCCTCATTTACACTCT
GTGGCCAACTCGAGCACCCCGCTACTTTGAGGTTCGATAGCAACAGTTTGTGCAATAGCAGGAGCGCTACTAACATCTTTGTGACGTGTAGCGCCTATAC
TCTGTGTCTTCACCGTCTGAGAAAGCATCGTTACGAGACCAACATCTCCCCTCTGAAGATCTTTAGCAATATAGTACCAAAGGTACATGCCGTATTTTGA
ATTGAGGTACTTCTCCGATCCACGAAATTATGCAGTAAAAAATTGATTGCCAGCAAAAATGCACTACTCGTCTGCTTCAAGTGTGCTTCGAGTAGCTAAT
AATTTTTGTTGTAGGCCTTCTATTCTCGACAAGGGCTGTTTTACATGATTGTCCTGTTGAGTGGTAGCCTTGAATTCCAGTATAGCATGAGCGTTTGTGT
CTCCAGTTGTGCCAGCTGCGAGAGCGCGTGAAGAACTTCATCAGTACAACTAGCCGAGTTGAGATCTTCTATTCTTTTCACTGTCTTCAGGGTGAGACTC
TGTGAAGCGAATGAACCAACATGTACATTAGATAAATTGCATCAACATACCATGAGCTAGAGGTACTGAGCTACGAACCTCCAGAAGATTTTCGAGAGCC
GCTATTGGCTCCAACATCTCGTCCATATCCAGCGCTAGTTCATCAGAACAGTCTTCTTCACTAATTACTCTAGAACCTCCGTCGCTCCAATTGTTGATCA
CATCCAGCACAAGCGCTCGCATCTTCGCCGTACCACAATTAGTTTAGTTAGTTCAGGAGTGAATTGCGTTGTAGTAGCAGCACGGAGTACGTACCGCTGA
GAGATCAGCCACATCGGAACACTGAATAATGAGATCAACTGATCGCTGTTGATCTTCTGACGGTGTAAAACGTAGGAGTATGAGGCTTCCTGTAAGAGTT
CGTAGTACTGTCCAGAGTTTTCCATTCTGCGTTCGACAGCTACGGCGTAATCGTGGAACTTCATCAATGGGTATCTCCAAGAGCTGACAAAGGAATGATA
CCATCCTCTCGACGCGAATCTTTTCAAAATCTTCATCCATGTCCTCGTCATCCTCCTCATCGTCTTCAGTGGAAAAGAATGAAGGAATAGAGATCACAAA
TCGGGAAGGTGGAGATAACGCCAACGCTGCCGATTCTGGAGGCGTAATTTTTGACCACACAGTTGCGAATGATGGGTTCGTTTGGGCATGGTCAGCCAGC
GCAGCCCACCATTGCACACCGCTCCAAAGTGCAGACGATGTGGCTTTCGATTCTTTGTTTGTTCTTTCAATTGGCATGAATGGATCATGGTTCTGGCGGA
ACGCAGAATGGATGGCAACCTGGCTGACAGGAATTTCTTCTTCTTCGAGGGGCTGACACAACTGTGCGAACAAGAACCGTCGGTCTTGCACCAGAGGGAT
CCCAAACGATAACGGACTATCCTGCTTCAGTGTCTTTGACTCGGTACAGTCTGCTTCTCTTTTCTTGTTTTCTGTATGTCCGCAACCTGAGGGACAAAAT
ACCATCGAGCATGATACCCGCAACGACCCCTGGTCTTGCTGAGCAAGCGTGTCTGGATCAAGGACGATGCTCTGTTCTCCACGCATTGTAATGGTATTCA
TCGGAAAGGAGTACGTCACTACCGCACGATGACAGATACGCACGTACAGGCACAAACACCTATTTACATAACAAATAGCATAGCGTAATGTCAGGTATAA
TCAAACGAGCAGCAAGTGAACGATGGTAACGACGTACCAGTCATCAAGTGAGACGATAGCTTCGGGATTGATGAAATGTAAGGAACATATCAATTTAACT
GTCTGTCGATCTGAGAAGCTTCCAGTTGTTATCATCGAAGCTCTCAGCTCGCACTTGACCACAGACTCGACACCTGCAGTAAGATACAGGAACTATAGCT
TGAGGCGACGATCACAAAGTATGATAAACAATTCACAAACCTGTTGTTTCCACAGCCCGCAGTATTTTCAAAGCCGAGTGCATCGTCATGAGCTGATGGT
CCATGTGCTTCGATTTTGCCCGTAAAGTAGATGATTTAGAGGAAATTTGCGCGATGTCTTGCAACAGATTTCGAACCCGAGGCTCACTCACTGGTTCGCT
AGTAGAAAATGATCCTCTGCATCTTTGATTTTGTTGCAATGGCAATGGCAGCACACTGACCACCATGGTGCGAAGACTTGCTTCATCAATAGTTGTGATC
CGCCCTGACGCGTAGAGAATCGATATACCTGCTGCGTCGATTTTTGTTGCCACACGCATAATACCCTGGTATTCAAGGTGATCAACGAACATAGTGTCAA
CATGTGTCAACTCCGCATCGGAACTTCGATCACGTACCGATTGAAGGGGTAACTTCGCTGCAGAAACACTGGAGTGAGTGGTGATGGGAACATTCGCTCC
TGGACCTATCGGGTGGGCTTTCACAAGTAAATCAGCACCATTGAAAGCAAAGGCAGAACCACTCGAGCAAAATACGAAAACTCCTAAACTGCTTGCGTAT
ACCAATGACTGCACTGCGCATCCAATCTCCAGCTTGTTCACTGGAACAGGAAATGTCTCCACTGAACTTCCATTCGCCAGCTCAACAACTCCGATCCTGC
CTCGAGAACCAACCACTAACAGTGCTTCAAATACTAGCGACGACAACGTTGGTTCATGTTCCTCCAAGGATGGAAAAGACTGCTCTGAAGATGTGAACGG
AACAATCATCTGAACAGGTTCATCCAGCTGAAGAAGCGTTCCACTGCGAATCACAGATGCCTTACTGGCATCTCCCTTCATACTAGAGTACTGCACCAAC
GAAAATCGCACACAACCATCTAAATCTCCGACCAAGATCACCGCCACACTCGTGTAGTTCACCACATACGGGAACAAACTCTTCAGCAGTCTACTGTGCG
ACACCACTTGACTACTCAAACAGAGGGTACATGTGGACTGCTCGCCTTCAATATCGTCCAGCTCCAGAGATTGATGACGCTGCAGCTTGGACTCGGAGCT
CCGGTGAGTACTCACAATCAAAGTAGTTGGCGTCACTACGCTCCTCATCAGCGTCAGTGACGTCAATCCAGAGCCAGCTGGAGTATGATCCACAGACTGT
ACTCCAGGCTGCTGACAGAACCATCGCACTGCTCCACTATCACTGTTATCACCACTAGACGAGCGTACCAGTAGCATTTCACTCGTCACTCCAGGCTGGA
AATGACTAGGCATGGTCACAACCCACACGTTTCCATCTGCAACCGAGACCAGAACTTTGTATCGCGTTTCACCACCTTCAGAGTGCGTTTCGCCATAGTC
TGCTATGTCTGTTATTGGCACCTTGGACCTGACCACAGCCTGACAAGTGACGGTCACGACCATTGGTTAGAGAATTCCTACTGCGAGAGCTGCATTCCAC
TCACCCACACTCGATTGCCACGGAGAAAATGCAACAGTGTTGGGCGGATTTTCACAGCAATACACGAGCATGATGCTGTCGTGTCTGATGTGCTGCTGGC
GGTCGCTAGATGCAGTAGGAACGGCAAACGGTCGGCTACGTGACCCAGCAGCGTCGAGCTTGACATCGTTGCGGATCAAAGCGCTGCCTAACCGTTAGTA
GCAGATACGTAACAAGTTCGTTAACGCCAGCAACATAACATGTTATCCTACGATTTGTGTCTTGCCAAAAAGATCTAAAAAAAGAGTTCATTTTGACTTG
ACGTTTGTATACCCTTACAAACCTCAAGTCAAACTTGCCGCGCAGCTTTGACTTGAAATGTGTATACTATACAAACGTCAAGAGGAAAGGTCTTGCCAAA
AAGATCTAAAAAAGAGTTCATTTTGACTTGAAATATGTATACTATACAAACGTCAAGAGGAAAAACTAGACCGCGCACATTTCCCATTTTCGAGCGCGCA
GATTTCACATTTTGCGCGCAGCGCCTATAACTTTCTACAAACACCAAGACATCCACTGTAGCCATCGCCGCCGGACCAAATAGACCAAATAAAAGCGCGT
GATCGCGCGGCTTTTTTTCTGCAGCCGCCGCGTCGAATTTGACGAGGCGCGAAGTGCGCACGTGATGACGCCGACTAGTAAGGTCCTGTCTTCGGAGGAC
GACGGCTGCGTCCATCTTCGGAGGACGCAGCCGTATTATTTGTGACAAATATTTTGGATCAAATAGAATAATGTTTGAATGCGGAAATTGGATTTGGGAG
TCCAGATTTAGGCCAGTCCTACTTCTACGTGCTCCAAATTCACAGATGTTACTTCATAATAAGTAGCTATTTCTAATTAGTTAAATTTGTAGCGAATAGA
AACGCTTCGTTGATGTTACTTCTTAGTGCACTTAAAAAATTCTGATCTGGAACTCCCAAAATCTAATCTCCGCTTTAAAACCATTAGTTGATCCAAAATA
CTTTTAAAGAATTCTGATCTGGAACTCCCAAAATCCAATCTCCGCCTTAAAACCATTAGTTGATCCAAAATACTTGTTACAGAACCGAAGCGTAGCCACC
AGCAATGGAGCACCTCCCTGACGGGCTGCTCGCACAGCTCTTCTCGCTGCTGTCCGCTCGGGACGTACTGCAGCTCACGTCCACATGTCGCGCGTTGTCT
CCGTCTTCGCCATGCGTGCAGCTGGCTCTGGAGCGGGTGATCACGCGTAGCTTCAGCGCCGTCACGACTTTCCTGCCGTCCTCGTCTTCCAACTGGCCGC
GCTCTCTGACCTTGTTACGTGGCGTCGAGATGCTTCACATAAAGGAGCTCCTGGCCCGATCTACCGCCAGATCCTATGAAGACGCTGCACTCTGCTCTCC
CAGCTGCGTCGTTGTGAGCCGCGCGTGGCTCGGCGCCTTCAAGAAACGTTGTCAGGCCTTCGAGCAGTTTCTACTGCAATTCCGCCGCTCGAAAAGGCAG
CAGAGACGGCAAAATGCAGCTAAAAAGAAAGACGTTTTAGTGTTGGAGAAGCTTAACATCACACCTAATTCGTCGCTCGTCGAGGCAGGAGCGATGATCG
TCTGCGCCCATGACGCACTGCTGCCCGCTTCTCAGTGTGTGGGTCGTCATCGACGTGCTATTATGAGTGGAGAGGTGTTCCGGGAGATTGCAGTGTATGC
GCCCGAGTTAAGAGGATTTAGCTTGTCGTCGTGTAAAGATTGCGCCACTTGTGTGCTGGAACAGGAGGCAAGGGAGCTGGAAGCTGAGGAGAAGAGGAGA
GCGAGGTTTGATGGGGAAATTGCAGGATCGGACGAAATGATGGAGCTGCTACAGAGGAAAAATGGATATCCGAAGGGTTTGTTCTCGCCAGTGGACTCGG
TGGGAAGCAGACAGCAGCAATTGGCACCACATTTGTCACTGAATGGGAGGAGCAAATACGCTACGTACTTCTTAGTGCCAAAGAAGTGGCTAAACAAGTG
GAGAAAATATGTACGCAGCCAAGGAGATGACGCTCCCGGACCAGTGTTAAATGCTGAGTTGGTGTGCTTGTCGCATCAAAGGACAATTGTACCACCATAT
ATTTCAATGTTCTTGTCGGGATTCACGCTGGAACAGTCACTCAAGGCCACACAAGTGTGAGTTGTATGATTGGTCTTTGTATTGACTGGTGTAGTTAATA
CTTACTTGCTTGTTGCTGGTATGCTACAGTCTTGGCTCCGCACCTGCTCGCCAGTACGAGATTGTAACGTTCGGTGAGTGGGAGGCACTTTACGACAGGT
ATTGTGCCGAATTCGCAGTAGGCTTTGATGTCATCAATGGATCGTACCACTGGAGGACGCAAGAATGTCAGATATGCAATTACGGTATGGGTGGTGGCCC
CTCGTCTAACCAGCCGAACTCAAGGCGGTGATTCCCAGGGAAGTCGCATTATGAGCCTCGAACGAATATATGGTGCGTTCAAAATGAGCATGCACATTTT
TATTGTTCACTAGTTTGTGCCTGTAAAGTTGTAGTAGGGCAGCACGGTTGCACTATGAAACATTTCGCCATCAAAGCGCTAAGTTGGAGATCCTTATCTG
TTCGATTTGAGTTTCGTCGAGGCACGAATTTGTGTGCTCGTATCAGGGTGACGTAAATCTGTAGGCGAGAGCTCCACGTTTTCATCCTCAAATTTGGGCA
GGGTGGTCACTCCATCTTGTTCCTCTATGGCTTTAGCACGATAGCAAGCTCCGATGATAGCTGACACGCTGAAGTTGGTAAAGTTTAGGCGACTACCAAA
GCGCAGCACTTGCGCCTCGTAGACTGCATAGTTAAACGCCATGAACCACCGCTTCCGAATCTCATCCTGTAGCTTTTTCTTGCGCACTGCCACTTCTTCG
GTGTAAATACGCCGTGACTCTGTGAGACCTTCGCCGACGATCATGGCAAACCCAAAAATTGTGACAGCGACGCATGTGCCAACAAGTAAATAACTCAATA
GCTGCACATTGATTAGTGACTCGACATTGAGGTCATTCAGTCGGATCATGACTCCAAGCCACAGCGTGAAATAAAGCTGCAACTGGGTGATACTTGCGAT
AAGATTATCCGTGTAGCCATCGTACGGCTGGAAGTACAGTAAGAACCACATCGTCATCAAGCTACAGAGTGAAAGCATTTGGCAATCCGTTAAAACATTT
CCCTGGTGCCACGCCCTAGTAGACTTACCAGACACCGATAGCGAGTAGAACTTGTTCGACACTTCCGTTCTCCACGAATACGATTACACCACTTAGAAAA
AGCTTTCGCGAAAGATCCACGACCTCAAACCACCAGTAATCATCAGTATCTGCAACAAACAGCAAGATAAGTATCATTTATAGTAACCAGGAATTACTGG
AAGCGCTTACATTCAGCGTAGATAAAGCCCAGTCGAGATTGCACTGTTGAGTCCTACATGCAGACATTGTAAGTCTCCTGTGTACACTTTTCAAGATTGA
TGAGGTGTACCTTTAAATTCTTGCGCTTCATGTATTTTGCTAACTCCTCCATTTGGACTTCCTCGTTGTCCATATTGCGAACATATCGTCCATCTGCTCT
TTGCTGTTCCTCGACTTCCTTTATCCATTTTTGTAGTTGTGTACGCATTTGAGGCTTGCGCAGTATACTGATACGCGCAGCAACACCACGGTCCTGTGCC
AACCAAATAAGGAGGCCAAAAAAGAATGGGATACCCACTACCCAGACAATCAACCCGATTGTTGCGATCAGACCAAATATCGCCCATTGCCCATTGTAAC
ATATCAAACGTCGATCAACCACGAGATAATAGACATCTCCAACTTCCTGGCAGTTGTACACAGTCAGGATTGTTTTAGAGACGGAAGGATACAAGAAGAG
GGCCATCCAACAGTAGAGTTTCAAACACTTGTTGCGATATGTCAGGTAGTTCATCCGCAGCTTCACTCTTGCTTGCCATACCCGAAGATTGCTACGAATC
GTGCGTTGAAGTATTGAACCAGAAAGCACATGCCGCTTCGCTGGACATTTCGTATGTACGGAACGAAACAAGCCCAGGTACGGGGTGCGTACTTGAGACA
TACCAAACTTGCGCTTCAACGACCGAGCTTCCTTTATAGTCGACAAGGCAATCGAGCTCGCATTTTCGGAAATTCCTTTTCTCTCCTCCACTTGCCTAGC
AGATGGATGATACTTATAGAAATTGCGCGTTCTCCACCAACTGCGAAGTAATCGAAGAGGATTGAAGCTTTCATCATCATTTTGAATCACCTCGCCTTCG
AGTACTGGCAGCCCGCAGCGCAAACAATTGCGGGGAATCAGCTGTAATTTCGCACGATAGCTGCGCATACCAGCATAGAAGTACGCCGTGATAACAGTGA
GGGCAAACACAACCAGAACAACGGTGACACTGGCATCGAAACACGTGGACAAACAAATTAATCACCACGAAATGATTAGACAAACAAGGAGAGCAAGTGA
ACTCACGTGAAATCAAAGTAGAAGTTTTTTGTGACCACACAGTCAATTCCAGCGATTGCCACCAGATCCTAAGCGCCACAATATTCATATGTTAGTCGAA
TAAATGTAAAAAACGATACCACAACTCCGTACCAGATTAAATTTCTGCGAGAAGTTCATGATGTTTTGGACGCCAGTTGACCACTTCACGACAAAGGAAC
TTTGGAAATTGCCAAAAATCTGGAAGAAGCCAATGAAAATCTTGAACTTGCTTGGTGTTACTGGAAAAGTCCTCGTTGGAGGACTAGCGTCCACACCAAA
GACCATTTTCGCATTTCGACTCTGGTATTTCTTGAAGAATGCGGTAATTTTGTCTTTACCTTGAACCACTTGCTCTGCCATTTCCATAGATTGTCGTCTA
TACGCCATATTCGTCCGCACAGCGAAATGCTCGCCCTTCTTAGTCGGGTCCTTAAGCCGCCTATCAGCCTCAGCTTTCGCAAGCAGACCGATTTCTGTTA
GGTCGCGTAGATATATCCGCACACCGTAAACTCCAGCAACCAGAGCAAAAATCAATAGGACAGGGATGACAAAATTCTGCCATCGAACTGATGCGCGAAC
CTGTGCATTTGCCTTATTACATGCTGCAGTTAAAACGAGGTAGTATATCCTTTGTGAGTATGAATATATAACATCTTTGCAACACGAAAACTGGTACTCA
CGCAGACACGAATTATCGGTGGCTCGCTTGAATCCGTCCGCACACACTGAGCAAATAGTGAGGCCGTACCCACTAGCACATGACACGTTATCCACACTGG
ATGAAAGTTCGATGGTCTGTAGTGAAACATCGGCATGGCAAGCATCTTCCACCTAGACAACCATCACACGAAAGATAACATAATGAGGAATGATTGAATC
CCTCCCAGTCTTATATACCCTCAACTTACATCACAAGTATAGAAGGTTGTTCCCGAGAGGCAGGAATAAAGTCGATCCGGAGGCCAATACACATTGAAAT
CGATGAGATTGGAACATTCGTTGATCACATCAGCCAGGTTAGCAGTTGAATTTCTGAGAGCAACTTTCTTGCACGGGTCCTCGCTCTTCCATCGTGAAGG
TTTGAGACAGTTTGATTCTTGTTTCGACGCCGGCGCAGAGAATAAATAATACCCTTCTTGTGTACGAGGATATGTAGTACCAAGTTCCAGTGCTATCGTC
TCCGTAGCACGCCGTACTGACATGTTACAGTTCGCGCCAGATGGGCAGTCAAAGCACTTTACGCCATCCAAACTACAAAAGCACAAGCAAAGCAAATTAG
ATAGTCTATCAATCTTCACTCATTGTTTGTCATACCTGTAAGTCTGCTTTGGACAGCGTTCACACACACTAAAAGACACAAAACAGTTAAATAAATAGCG
ACAACTGAAGTACAAGCATAGCACTTACCCCTGATTAATAGAGAATCCAGGTTGGCACGGCAACAGCATTACGTTCTGAACAAACGCTCGCGGTTCGGAC
CCCAACAATGTGCATGAAACATTTGTCGTATATATACCTTCTTCGGGTGTTCGGTTAGCAGCAGTAAAAGAGCCCTCGCGAAAAGAGATTACTCCAACTG
CAGCGCGAACACCAGATCGAGGCTCGAAAAATATTCGTTCTCGTTGCTCATTGCATAGGCCGTCGCTTATATAGCACTCCGTTTGGTTGTCCAGTACTTC
AACTTGTCCATAGAGATCGACAGCTTTGAGGCGTGGCCACACATAAGTCGTCGATTCTAGAGTTTTATTCCTTGTTTCAAGCACTTCGATAGACTCTTCG
TCAGGAAACTCGAGGATAGTCACGCCACTAGTTATGTTATCGGGCCACCACATCACATGAACGTCGCGCGTATTGGTCGCTATATCGTATACTTCATTTG
ATTCCATCATGCATGATGAGCACGGATACTTTGGCATCAAATCTTCGTCATTGGACACCCAAAACATGCACCCACCACTTGGCGCCGTGTTTCCTTTACA
CGTTATTCCAGAAGTTGTTGTATTATCAATCGATTGGTAGTAGAGTGCCCCACCACGAGTGAAGGCCACATTAGTGATAAACTTGGTGTTCTTGACACTG
ACAGTAGAATGACCATCAGCATAGAAAGCTCCACCAAGGGTGGCGCTGTTACTGGTCATCTCTCCATTTCTTAAAGTAAGTGTGGCTTGATCAGTAACAT
AGAGAGCACCTCCATCTCCACTGGCTTGGTTATGAAGAAAAACTACTGAGGTGAGTGTGGAAGTTGATATACCGTCCACCGCGACAGCCCCACCTATATA
TGCTGTATTGTTTTCGAAAGAAGTAAGCAAAGCAATCGTGACCTTCGCCTTTGTACCTGCTGCAATCGCGCCTCCGCTTTGATCTGCCGTATTTCCTGTA
AATAGTGAGCTCATGATCGCTACTGAACCACTGCGGTCAACGTGAATTGCTCCTCCAACCACTGCAGTGTTGTTGACGAGAGTACAACTTGTGAGCTTCA
CTACACCATCAATGGCAGAAATTGCTCCACCGCCTTCATTTTTTCCGCTGGGGGTCATACGACCATTTCCCACGAAGTGCGACTTGTAGCCAGCAAATAC
AGCTTCTCGTCCAACGAAGACACCTATCAGTAGTTATATGATAACATTAGCCGTGAGTAAGATGAGATTAGTTCAAATGAACGGAATATTGTAAGGTACG
TACCACATCCTTCTCCATGTGCGATATTGCGCTCCACAGATGAACCATTTAGAGTGACAGCATTTTTATCTCCTGTATCGAGATAAACTCCCCCTCCCGA
ATCGTCGGCAAAGTTGTCCGATATGTCTGAGTTTTCAGCATAAACTTTAGAGGATGTATCAACAAATATTCCACCGCCGGAGGTTTTGGACTCTGGACGA
CAGGATTGAAACATTTATCAGTCAAACCATTCAACAACAAGTATCAGATAAACAAGCGTACCGCTAAGTATCACTTTCACAGAAATAAAATAGACTTGCG
CACTGTTCGATGCACACACACTACCCCCTCGCGCTTGTGCAGTATTGGAACTGATTTCCGAGTCTTTACTATAGAAATACGCATTTGCGTTTATATAGAT
TCCTCCACCAGCGTCTGCAGTTCCGTATGTCACGAACGAAGAATCCACCTCAACAGAAGAGTCTGTGTCCGAGAGATAGATGAGGTCACCCTTCTGGACA
TCCACCAAGTTCTCAGCACGTCCTTTAACGTACTCAAAACCCACTAGGTATAGAAACAGATCTTGCCAAGTGTCCGTGAAAAATCTGTCCGAGTCACGAG
TAATAAATCCTTCTCGGAAAGTAATATCTGATGCTTTAACTGTAGCGATGGAGCCTCCAACAGTAGCATCATTTGACAAGAACAGCGATGAGTTAGAAAT
GGCAGTAGCATGGCTATCTGCGTATAATCCACCTCCCACTCCATTCTCGCTATTACCAGCGTGATTTTCCACGACTAACAGTGTTGAGATATACGCATAA
ACCCCAGCAAGTGAAATAGCCCCTCCGTACGATTTTGCGGAGTTATTGTAAAATACACAGCTGTGGAGCTTTACTTCCGGATAGAACTCCAGTTTTTCAG
CCCATAATCCACCTCCACGATCACTGGCATAATTTCCCACAACAGACACGTTTTCAAGAATTGTTAGATCGGCATCACTAACAGCGATTCCACCACCTCG
TGCAGCAGAATTGTTGGTTATCAGTGAGTTTGATATCGTTGCATTACCACGACCAACAATAAAAACGCCAGCGCCTTGCCCAACTTGTAGGTTTGCACCA
GAAATTATACACCCAGAGATGTTACAGTTGCTGGTGCACGTAAGAAGGACGTTAGCACCATTGCTCCCGATTGGATCGACAATATTTGCATCGATACGTG
ATCTCTGAGTCTCAGCAGCATCCCACCATAAAAGTGCTGCTGGTAGCAACTCACTGTTAAGGTACACCCCTCCAGCGGTTGGGGCCACATTGTTTGCAAT
TTTTACATTTGAGTGATAAATTGTAGCCTCCTGAACCATAAGCCCGCCTCCGGATTGAACAGCCTCGTTGTTTGTCGTCCACGAGTCCCGTAACACACAA
TTTGTGCCAGACCCAAAGAAAAAGCCGCCTCCAGATTTCATCGCAGTCGAGTACGAAATTTTAGCGTTGACCACGATACACCCTTGGACATTGAGAGCAG
CTACGCCACCACCAAATGTAGCATTGCTACTGGTGACAATGATATCACGGATAAAAGTTCCTTCTCCATCAATGAAAATGCTTCCTCCATACTCGTCTGC
AGTGTTTTGAGTTAAAGATGCTGCGTTTTGACTCATAACAGTACTCTCATCTGTTGGGTGTTGATAGAATTCTGATGCGTTGGCATAAATTCCTCCACCG
CGTAAGGATGAACAGGACTGAACGACAACGGCGTAATGTTTTACAGTGGCATTCATGATTGAGATACCTCCACCGACACCTTGCAGAACAGAACACGACT
GGATTGTAGCGGACTTCAAAGTTAAGGTACCCGTCTCAACTGCTAATCCTCCACCACGCTGTTTCGCCGTATTTGAGGTCATAGTAACACCTTCTAATGT
GTTGGTACCAAATGTGGCCACACCGCCTCCTTGTTCTCCACTATTCCGATTTACTGACATTAAGCCTGATACACTTGAATCAATAACGTATACCCCGCCA
CCAGTTACCGCGATATTGTCTGTCGATGCCACATTTATTACTTTGATCATCGAAGACTGAATATATAATCCCCCGCCATTTTCTGTCGCCTTGTTTTCGA
GAACCTTAACAGAGTTTATTGTCGCTTCCGACGCCATTTGCGCGAATATGCCACCTCCCAAAGATGCATCGCAATTCGTCACGTCAAAAAATTGAAATGA
ACTTTGGCTGCCAGTGATAAATACTCCTCCAGCTGTATCATTAGCTTGGTTGTCTCGAATCATTGATGATATATCGTTTGCCCCAACAACTGAGCTGGAG
TCGATATACATACCAGCTCCACTCACTGCGGTACAGCCGGTAATTGATGCATACAGTAACGATAATTTACTACCCATAGCAGCATATACCCCACCTCCGA
TAGGTGCATCACAGCCCTCCAAATCGGCGTTATTTAAAATTGCTGAACTGCTGGAAAAAGCAGCACAACCACCTGACATCGTAGCGGAAGAAGAACGTAT
CCTAAGGCTTGTTACAATTGGGAGTGTCCAGTCAGCTGCGTAAAATCCTCCACCGATAGCTGCCAACATTATATCAAACAAATTTATGATATGAGCATAA
AATCCTTGTAGTACTTCGCAGTACAATTTAAAATATAATCTTCACGTACCTGCGGTGCAATTTGAAATTTCCGATGCCACGTTTTCAAAAGTTCCATTAG
AATCCATATAAATTCCCCCACCGTAGCGATCTGCCGAGTTCGACAGTGTTGGCGAGTTTTGCAGCACTAAATTTGCAGTATTTAGTAGTGCGATTCCTCC
ACCATCGCTCTGTCCATAATTTTCGACAATACTCACATTAGAAACAATAGAATTTCCACTGATTACAGCAATTCCAGCCCCTACTGGCGCAGAATTTTGC
AAGATATGTAGCATACTCCCACTGAATGTTCCAGCTGCACATATCCCACCGCCATTCAGAGTGGCAGTATTATTCAATATTGTGCTATCGGTATCACCAC
TCACTGTAACGCTGTTTTGCGCAAAGATTCCACCGCCTTGTTTTGCTGCAGATAGCTTGATCGTCGAGTGATACATAGAGAGGATGGATTCATCTAACAT
TATCGCCCCTCCTCTCAGGAGTGCTGAGCAGTTCGATAACTCCGAGTTAGTAAGAATCAGTTGTGACTGGTACGCATATATTGCACCCCCGCTTTGGCGA
GAATACCCATTAGTGAAAACGATGTTTTCCATCTCGACAGATGCGCTTACAACGCTTACTGCTGCCCCATCGGTATTTGTAACAGCGTTTTGCAGTGTGA
ATCCAACCAGTCGTATTGGTCCGCTCGTAATTATCAACCCCTGAAACAAATTTCCGCAATCAAACGTTGTCACAATTTGGCCTCGCAAACCTCGAATGAG
AAGCGAATTGGTTGCTACTGTCAAACCACAGTTGTTCGTCCCAGTGTAAACTCCAGGATACAGTAAAATCGTCTGTTCGGGCAGTGCGAGTTGCAGAGCA
CGTTGGAGCGTTTTCACAGCTTTAGGGTCTGTTCCAGTTGGCGAGGTATCCATACGCTGACCAGTTCCTTGTGTGTCATCTCCATTGACGCTAACAACAA
TCACATCGTTCTGAGTCTGGAAGCAAACGGGGTCACATGTCGAAATTGTGCACGTGGTCGGATCTTTTGGGCAGATAACAGCGTTGGTGCAGCTCTCTCC
AACATATCCGGTAAAGCACGAGCAAATACCCTTCCGACACGCACCATTCAAAGAACAATATCCATTGGAGGAGAGTGGGCATGGAGTGTCAACAGACTCT
ACAGCATCGGATGGATCGACTGATTCGTAGTAAAGGGCCATCCCTTCGTACGTGATACTTTCGTCCGACGTAAACGAAAGAATCACACTATCGAGACCAG
GAGCAGTCGATATGACAAAATCTCCTTCACGGCGACATCCTCCCTTCCAGAGCTGCTTCGTCGTGCCATTCGATGTTACTTCTATGGTTAGCTGGTCGTG
ATCACATTCGAGCCAAAACATTGAGAACTAGACCACGCCCAACACAAAATATGTTAGTATGAAGTGAATACGTCAAGAAATATGCAGACCTACGGTAATC
GTCAAGCCAGCTTGATTCTGAGGTATGATAGTCCACATTTCTTGATCCAAGTTCTTGTATTCGTGCCAGTGAATATGTCCTTTGCTGCCGAGACAATCAA
ACCCCCTTGATGCTGGAGTCGTGGCGACAAATGTTGTAGCTTCACTTAAAACGCTAATGGAGCCATCCAATCGTTTCACTTGGACTTGGTACGAATATGT
TGCGCCCATTACTATATCATCCTCGAATGTGATGTCTTCGCCGTTGTCATGATAGGATTCTCCATTTCTATAAAGAATGTAGCTGACCGCGTCATCCTCA
CTCTCCCAAAAAACAATCGCCACTTTACGTGAATCTGCAAACAGAAATCTCAGTGTCAGTAGGTTGACCGACTAGCTCGACATTTGAAACTCAGTAATCT
TACGACATCCAACCGCCGGTGGTGGAGGCTGGTCGGCATAGCGTGGGGTTCTGAAAAAGATAATTTTGCTAGCTTCTCCTAGCTGGTTATCACCAGTGAC
TGCTCGCTGTAATGACAAGACCAAAACGGTCAGCTCACGATGCCTTAAGAACAAATCTCATAGTATAACGTACCACCGTCACAGTATAATCGGTAAGGGG
GGACAAACTGATGATAGTGACGTTCTCTTGAGTCACGGGGACTCTTGTGGAAAAAGTTACGCTAGTATCCGATGTTTGTACGATGTCCACCTGATAAGTT
TCAATGTAGCCACCACCAAAATCGATACAGGGGGACCAGTGAATGGAGGCGAAAGTATTTGACACATCAGCAATGTGAACATCTTGAGGAGCTCGAGGGA
GTGAAGTTTTTGCCGTTGTGAACGTTGTTATTTCACTTGAGGGAGACGCTCCAACATGGTTGTATGCAACGAGAGTTACCTCATAATCCGTGATAGAGAG
CAAGTTTCCGATAGTGCATGAAAGGATCATTCCCTCGCAGCTACCTACTTCAGTGCCCAATCTTGTCATACTGAGTCGATACCCCGTTAATGGTATTCCA
CCTGTGTCGACTGGATCAGACCATGATACCCCAATGGCACCACCTGTGATGGATGTTGCTAACGGTGGCTCTGGGGCCTCTGGAACAGTAGGTACTGAGG
TCACGGTTGTTGCTTCATTAGTGACTGCACTTACTCCGACGTCATTAGATGCTTGGATTGTAAAAGAATAAGTCGTAGATGGTAGTAATCCCCCTGCTTG
GACATAGATAAGGGATCCGTCACCTTCAGCAAGTTCTCTTCTAGTTAGACGACGACTATTAGGAGTGATGGCAATTGCAGGTGCAGTTTGTAGTCGACGC
ACAGCATCGGCCGGGAGTTTGACACCATTTGCGTACACATTCCACACTAGATCATTAACTGTGACGCCTCCCGTATCTTTCGGAACTTGTATAGATAACG
TAGCAGCACCTCCCGACGATTTGAGAACGATTGGAGTTCCTGGCAATGATGGTAGTGTGGGTCTAGTGGTTGAGAACATTTTCACTCCAGCATCCGATCC
TGTTCCCAAGCTGTTACCAGCATACACCTTAAACTCGTACGTTTTGTTCGCAAGTAGGCCTCCGAAATTTATCTCTACCGTTGTTGCATATTCGACCATG
ACGACACTATCACTTGTAGTTTGTCCATTCACAACGTAATATGTAATTACACTCCCACCATCATCATCGGGGCTCTTCCATGAAAATGTCACCATGCCAC
CTGTCGCGTTTTTCAGCTTCAAGTCACTAGGTGGTCCAGGCGGGGATATGAGAGTCGTCCGAAGCGGGTATATTGACGAATTTCCCGAGTAGCCGACTTC
ATTCATGCATGAAGCCATGAACAAATATTCAGTGGCTTTTTGAAGATTGGTTTGCCAGTAGGATACGTCAGTACCATTATACACAAGCGTCCAAATTGGT
ATCAGTTGGCTTGGACTCATGTACACTTGGTAGTACAATTCTTGATCACTGCCTCGGTCGATTGGAGCTTTTATTTCTACATGAATTCCACCACCAGTGG
CTCCAGTTGATTGGATCAACTGAATTAGAGTTGGTTGTGATGCCACGTCAGTCTGGAATATGCATTGGTCTGGAAGACCATTATCGACCCCAGGACACGC
TGATACATCATTCAACGGAATGTAGTAGAAACTGTAATTTGTTTCAGGAGACAGTCCGCCAATCTCAACTGTGACTTCCAGATCAAAATCACCATGCGAT
TCGTAGCGATACAGTTCTCCATCAACCTATGGTGTCAAACCGCGTTAGTGCCTATCGAATGTGCTTGCAAAAGTAACGTACCGTTTTGTTATCAATGTAG
AACGTGTACCCCGTAATAAGAACCCCACCTAAGTGTTTATGCATCAAAGTTAGCCACGCTGTCACTCGGATGTACACTCAGCAAGTAACTCTTACCTGTG
TCATTTGGCCAGGAAATGCGCACATGGAGCGCACCACCTGTGGAGTAATCGAGCGTGGCTCCAGTTGGAATTCCTGGCCTAGTAGGAGACGATGTGGTAA
AAGTGGACACCGCACTGAACGCGCCTCGCACGAATACGCTATACACATCACCATTTTCGAGATCTGTACTGGTAATTTCTCCGTCACCTGAACTAAACGA
AGGCAAGTAGTTAATTGTGCTGTTGGATGGGGTTATTGTGGAGTCGACTTGGAAGATATATCCCTGAAATTGTAATCAAAGGTTAGTTGATGTACTAATA
ATGATGCAAGTAGGAACTTACTCCAAAATCGAAATATTCACTCTTTGTAAGTTCATCTGTCACAAGGTCGCTCAGACGAATGTTTGAATCAGACACGGAA
ATGTTTCCCAAAGTGAGAGCATTCGTATCACTGTCAAGGATCGAAATTCCAACCATATCGTAGGCAGTATCCGCGGCTAATCTGAATATAGTCATTTCCA
ATTTCTCGGCGAGATAGTAAGCCAGGCGAAATCGCTTGCCTGAGCCTTGTTCACGGTAATATATCATGTATGTCATGTTTTCGTGGCCACCTGTTTATAC
AAAATAGTACGTGTACAGTATATAAAGCTTACGTTAGAGCGGGGAAATACAGTAGCGATTGATGGAACTTGCCGGTATCAATGGGAGGTTGAAGAAGCAA
CGATATTGCTCCTCCAGTTCGGGATGAATATGTAGCCGGTAGTCCGGGTGGTCCAGACCGTGATAGAGGGCCACTAGTAAAATTAAACAGCTCGGACATG
TCTCCTGTGCCTATAAAATTGATAACCTGCTCTTGCAGTATCACGATATGTCACGAATGCACACATCTTATAGCATGTAATAGTGTTCTAGAATAAAAAC
AAACCTGAGCTCGTATACTGTACGCAGTGTCTGCCTTGTTGACACTAACAGGTATCAACGACGAAGGCTGTCCCGTGCCGTTGTAGGCCAACTACAAGCA
CAAATAAGATTATTTAGCTCGAAAGTATCACGCAGTTGTTAGAACTCATTCCAAACCTTGAAATCTCCTCCTGCTAGAGCTAGGTATAACAAGTATCCAG
TTATTGGGGCTCCTCCAATATCAACAGGAGTGACGATAGAGACAGTTAGTAAGCCTCCAGTTTTGTTAACCAAAGAAATCTGTGCAGTTGGTCCTGGTGC
CGTAAAATTTGTTGTGTCAAATGAGACACTGTTGCTGTCAGAACCACGTCCAATAGGATTGATAGCTGAAATGGTGAAGTTGTACGTGGTTAGAGGATTT
AACCCTCCTAGAGCTTGCAATGTATTGCTCGTTTGCGTGAGTAGCCATCTTGTGGTGCTAGCAGTTCGAATAGAAATATTGTATCCAGTGATCGAGATAT
TTTGGCCACCAACATTTACAGGAGGTTCCCACTTCAGTTGCAGCATTCCTCCCGTTGCCCTATCAAGTGACGGTGCTTTCATTGCACCAGGAACAGATCG
ATCTCCATCATCAAGTACCACTACTTTAATCACACTATATGTCCCGATCTTTGCTGCTCCTGCAGCTATTTCGATTGTGAGGTAGAAATACAGGTAAGGA
AAATCATAAACGTCGTTGTCTTTGATCACAATACTTGCGGATGAAGAGGTCTGGCCATCAATAAAATCCACGGTAGATAAAGGTAGCCGGAATCCAATAT
CGGGTTGTGTTGTGCTGGCAAGACCACTGAATAAAATAATTCGCGCACTAGTTGCAGTGCTTTTACCGTATAGACGACGTAACTGAAGAGGCAGAATGCG
AGCATTTTCCATGACAGTAACCTCACTATCAACAAACCCAATCATTCCGGCATCACCATCGTCTACAATCGTGATTGTAAGTAATGCAGGTGGAAATGGA
TCACTGCGTTCAGGTGTTGTATCAGTGAGAGTCAGGATGACGGTCCGCGGAATTGGCTCGTAGACATCGTTGTTGATAATTTGTACATCAAAACTTTGAA
CCGTCAACTCGCCAACAAACGAAAACGAACGGGATGGTTCGGGCGGCAAAGTGTAGTCTCGACCATAGGTAGCGGTACCCGCTCCGATGGTATATCTACA
GGAAATTGTACTTGAGGAACCATTCACACGGAGCAATTGGACAGTCACACTCGTGACATTTTCAAATACAGTCAAAGATCCCACATTGAATGCAATAACA
CCTCGTTGTGTCACATCTGTTTCAGCTGACAGATCGGGTGACCACATACTGGTCCCAGCCGAGTTTTGAGCACGTACACGAAACATGTAGACATCACCTG
GAATTAGTTTTGGTATCTCAATTGTCGTAGTGTTGACCTGTGTATTGCCACTTTCCGAAGTGTTTGCGTTGGTATAACCGATTTCGTAGATAACCTCGTC
TCCCCCAGTATCAACGGACGCATCCCATTGCAAGAAAACTGAAAATGCTGTCCGAAGCGTGACGCCGAGATTCATTGGAGTCGAAGGAAGTGTTGCAGGA
TCCATCCTCACTTTTACCGCATCACTACGTAGGCCCTCTCCAATGATTGCCACAGAAGAAAGAGCAGACACTGCAAAATAATAAGTAGCGTCTGCGTGTA
AAGGTCCAATCTCAACTAGTATGTAGCGAGTCGTTGAGTCACCTAATACTGCTTGATTGCTTTCGCTCACCGAGATTGATCGGGTTTTCGATCCGTTTTG
ATACAAATACAGTTGATCGATCGGTGTTCCACCATCATCAATTGGGAGATACAACTTTAGTACTATCATCCAAGCTTGCAATCCCGTTGTATCATTATTT
CGCTCAGGAGCTAACGGTGCGGCTGGGCGAACTGCGACTCCGTTTGATACGATTTGTTTGGTCGAACTTTCACCTATGCTGTTGCCAGAAGTCACGACAA
CAGTATACGACATGTTAGCTCTTCTACCAAAAAGCGTGTACGATGTTTGGGATGTAGCTATCGTTGTGGAAAACGCAATACTCGAACCAATCAGCACATC
TAGACGAAAGAAAACCAGCGGAAGCCCGCCTGAATCTTCGGCTGGTACCCATGCAGCAGTGAGGTTTCCACCTAGTGCACCAACAACAAGCTGAGTTGGA
GACATTGGAACAGTAGCTTGAGAAGTAGTTGCATCGAGGTTTGCGCTCAAAGCGCCTAATCCAATTGAGTTGGTCGCTTGAACAACATATGTGTATTGTT
GCGAAGCAGCAAGGCCATGATCATCCAGATATATCAAAGTATTACCTTCCGCTCCAATGTCAGCTCTCCAAGCACCATTACGGTAAAGTTTATACCCCAA
AATTGAGTCTCCACCATTGTCCACTGGCATCTGCCACACCAATCCAATTGAACCGCCGGTGCTACTAGTCTGACTTAAAAGAAGTGGTTGGCTTGGTGCT
ACAATGTTTGACTTAGTACTAGCGACCACAGGTGAGCTTTTGAGACTTGTTCCCGCAGTATTCCATGCGCAAACACTGTAACTGTATGCTGTGTTCTTCG
TTAGATACCCACGTGTAAATACAGTGATCGTACCATTGTACAAAACTTCACCAGCGTTAGAATACAGTAAATATGCTACAAATGAGTCACCTCCAGTGTC
CTCACTCGCAGACCACCGAATAGTTTGCATCCCAGATGTACTCGAGATAACCGCTAAACCACTTGGGGTGTCTGGCAAAGTGACCGACGGATTCGTGCTG
GTGTAAACAATCTGGCGAGTGAGCATAGCCGAAGGATCTGCGCATACACTGACGTCATTGACACCGGACACTGAAAATCCGTAGATGGAGTTTGCCAAGA
GCCCCACAATTTTTGCCGTAATTGATGTCGAGTTTGTAGTAATCCCCGAGACCCTTTGCTGAAACTGAGCTTTGACTTGATCACCAAGGAAAAACGATAC
GTCGTACGCTGTCACATCAGCCCCACCAAAATCTACAGGAGGTAACCAAGAGAGTGTGACGGATCCTCCAGTTCGAGAGAGTGCTACAAGATTTTGAGCT
TCGTCTGGGAGTGACATATACTTTGTGGTAGTTGTGACAACATCACTCAATTCGCTTGTACCCTGTAGACACAATGTTAGTGTTGAATGGCAGTCCAAGG
TGAATATGGAAATGTAATAACTTACCACTGTGTTGGACACTTTGTATTGTAGCTTGTATGTCGTAGAAAATGTCAGTCGCGTGGCGTAAAACGATGCTGT
GGGGCCTTGGTAAACTTGACGGAAGACAGTCGGGTATTGGGCTGACGTCATCAACAGTGTATAGCTCAAAATGGGGGTCCCACCAAGATCCAGCGGAGGT
GCCATACTCACAAGCAGTGCACCGCCTGTCACTTTTGCTATGTCCAAAGACGTGGGTTTTCCTGGAATCGATGCAGCAGTGGTTTTGAACACGACAGCGA
TACTTGCTTCCCCAACAAGACCTTCCTTGTGGATAGCTTCCACGGTTGCGCTATAACTAGTCAATGGGGACAGATTGTTCGTTGACGCTGCGCTACTATT
TGACGTATACGTTCCCACAAAATTCATGTCGGAGCTTGTACTCACATTTACTCGATAACTGCTAATATCTGCGCCACCGAAGTTAAGCGGGGGTTTCCAC
GACAATGTTGCCATTCCTCCAGTCAGTGATAACACTTGAACGTCTCGAGGTTTTGACGGACGTGTAGCAGCCCCCATTAGGATTGAGACAGGAAGTGTAT
ACGCACCAACAAAGTAGTTGTTGCTAGCTGCAATGGAGATTTCATACGCCGTTCGAGCTTTCAGCTGGCCGATGATAGAGCTAAACGCTTTGACGGAGTG
GTCTCGTGTGGCACCACTCTGAACTTCGACAATGTGCGCGGTGTATAACAATGTCGTGACATTTTTCGCTCCTAAATATTCAGGCGCCACCCAAGAAACT
TTAACAGTTCCACCAGATATGGCAATGACTTGAACTGCGGTCGGTAAGCCTGGTGGTGAAGTATCTCCGTCATCCACAATTTCAATTGTGGTGGTAGCTC
CAGAATCACTAATACCAATGCGTCCACTGACCACACGAAGCTTCAGGTTGAACAATTTTTGGGCTTGGTAGGTTGAGTCGTTCAGAATTGTAACATCCAC
TGAAACCTCCTTTTGTTGGTCAGCAAACACAGCGGTTTTGTGTGGAATAACGTAGTCCACGCCTTCGGTGGCATCGTCGGGCGTATCAACTATGTCAATT
GCGATAGTACTATTTCCACTGAATTTCAATTTTCTCACAATGATTAAAGAGAGGGTAGGTACAGATTCTGAAACAGAGTATCGATTCTGCCCAAACGCCA
AGATACCGGCGTCTCCATCATCTACAATGATAACTTTTACTGTAGAGATATCTCCAATTGCACCAGAGTCGTCGTCATATTGCTGGATTGAGACAGAAAA
ATATTTATCTGGATCATCAGTCACGTCATTGTTGATGATTTCAATGACTATTTGTTCAGATTTCGAGCTCCGCTCGAAGTCTATTTCACCACTGGAGTGG
GTATACTGAGTACCAGCGAGTGCCGTTCCATCTTGTGTTGTGTAAATGCACTTCGCAGGCATGAATCCCCCCATAGTACGCAGCAACGTGAGGCTTATCG
AGGCATCGCCTTCTGAGACTTTAACTTCCCTGCTCTCAAAGTTTATCACGCCAGGAGATACAGGATCTGTTGTTACGGTTAACATCGAAGACCATGGACC
CTCACCTGCTAAATTAATTGCACGAACTTGGATAGTATAAAGGGTTGAGGGATCCAATGCAGTTAATGTTAAACCGTTCGTGTCACTTGATGCGTGGCTG
ATGTTATCAGCACTTGAATTAAATTCAATGTCGTATTCCACTGCAGCTATATCTCCTCCAGTGTCTTGAGGTAGCATCCATGTAAGCTCAATATTCTCGT
AGGTCTTCGATATCGCTGATAGATCCCATACGACACCAGGTGGTGTAACATTGGAAGTTGTTACAATCAGTGGATCGCTCTGCTCGCTTTTACCGATATC
GTTGATCGCAGATACAGTGACTGAGTAAAACGTGAGAGCCGTTAAGCTAACTAGATCATATTCAGTGTCAGATATTTCCACCATATCGCTCTGTGTCCCG
TTCACGTAAAATTGGTAGTCAACAATATCGTTTCCACCAAAGTTGACTGGTAAAGTAACACCGAACCGTATACGACCTCCCGTTATCTCCACTAGTCTAG
GAGCACTCATCTTATCAGGAGCAGTAGCAGCCGTTGTAGTAGCTATCACCATACGAGATTCACTTTTACCCACAGCGTTGACAGTCTGGATCAGAATTGA
GTATTGCACATCCGCATAAAGCCCATTTACCGTGAAGACAGCCCCCGATGTGTTAAATTTATCAACAATTGCAGTTCCCCGAAGTATCGCCAGCTCAAAT
CGAAGAAAGGAAACACCACCTGTGTCAGGTGAAGCCGTCAAACTGAGCATGAGAAATCCTCCACCAGATTGAATTGTAGCTGATGGAGCTGCTGCTACTG
TTGCAACACTACTACGAGCCATAAATGTAGTTTCGTTTGTACCAGATACGACGTCATTCGATGCAAATACAGAATATCTGTAGTTCGTATCGGCCAGAAT
GTTGTTTTGGTCTCGAAACGTTGTTGTTCCGTCGACAGCTAATGCGATGCTGATTGAAATATTATCCCGAAGTATGTTGTATTGCTGCACTTCTGCTCCT
CCTGAGTCATCTGGAGCTTCCCATGCTAGAAGGATGGTTCCACCAGAAGAAGCCGATATTTGACGCAATAATTTCGGAGGACCTGGGGCACTTGTCGAAC
TTGTAGTCACATAAAGAGATGCTGAATACAATCCGTAACCTCGTGAATTCTCCCCAGCAACCGCAAATACATAGGACGTAGAAGCAGTAAAACCATACAG
CGTTAATGATGTTGGAGCTGTAGCGCTGACGTTCGCCAGTACCTGAACCTCACTGTTTTCAGCACCACCTTTGAGAAGATACCACCGTAGCATTTCTCCT
CCTGAAGATCGAGGAGGGTCCCATGCCAACGTAACAGCTCCACCTGTCACTTGAAGTGTCCGAAGATTTTTTGGTTGTGAAGGAACAGTGGCATCCTGGG
TTGTTATACGAAGCTCATCACTTGGCGTAATGTCTTCATCGGGATGACACAGTGTTCGGAAATTATAAGCTATGACGCTGAAAGCATAGTCGGTGTTGGC
CACTATATTCGAGATCAAAGTCGTTTGGGCTAATGATGTTCTGTTGTCGTACACAACTTCGGGAAGCGACCAGGAACCGTTTGCGAAAAGGTGGCGCGCC
TGCACTTTATATCCGACAATACCAAGCCCACCTGAATCCAATGGTGTACTCCACTCTAGCGTAATCTCTCCAGGATCCTCAAGCGCAACTACAGGTGCAG
CCATTTTGCCAACCGCTGTCGGACCCGTAGTGAAATATCCTTTCTCTTTACTTGGAGGGCTCCACCCCTACAAACAACAGTGATTTGTTAATAAAAATTC
CAATAAATGTACGCAAGTATGAACACACTACCTGCACATTCGATACGGACACAGTAACGAGGTACTCGGTGTTCGATAAAAGGCCGTAAATGGAGACATT
TGCAACAGAACCATCATAGGACAAGGATTGAACGCTCTCATATGCGTATTGGCGATAATTCGAGTTTCCTTGAATGTGTCTAGCGATGTTGAGAGTATAG
TAAGTCAAAGCCGAACCACCACAATCAATTGGAGCAAGTATGCCAACATATAATGCCCCACCAGTGGCCGAGAGTAGTTTCGGCGGTGGTGGTTGCTGTG
GTGACACAGCTATACTACCGGTCGAGACACGAACAGTTGAATCTGATCCTATCAGCCCACCTTCGTTAACCCCGTGCACAGAAAATGAATACCACGTAGC
TGCTGCTAGGAAACTTATCGACAGAGAAATCTCGGAGCTAGGAACTTCAATGAGTCGTTTTTCCTGCGTAGATTCGGTCAGGATAGTAACCTCGTAGCAT
TTTAATGGCAGTCCTCCTTTATCGAGTGAAGATTTCCACGATAGATTCGCATACCCGCTAGTAATTGAGTCAACGAGAAGTTGAGTAACTTGACTTGGTG
CTGAAATTCCCCCTGTTAAAATAGTGATACTGCTGCTTTCGCCATCTCCATAACCATTATTGAACGTAGCATTAGCAACATACGTTTTATCGTGTTCGAG
GTCACACATATTGATACTATTTGCGATAGTAGTGTACGATGCATGGAAGCTGTCGTTCGATCCAAAAACGTTAACTGTGTACAGGAACGAATCTGTGGTA
CTTCCCCCTGTGAAATTCGGCGGCTGCATCAGTAATTCAAAGCATCCACCAGTGATTAATCCTAGTAATAGTCGTGGCCGACCTGGTAGACTCATGTCCC
CTTTGTCCTGAACAACCACTGTCAAAGTGTTACCAGTTACAGTAGCCCCACCGGTAGGGTTTGAAAGTCTCACCACAAATCGCCTTGTTTCGTACTGGTC
GCTATCTCGAATACCAGTGGTCACAACAGCTCTTCCAATGCCATCTACAAATTCCACAACTTCCCGTAGTTGATTTCCACCTATACTCGAGCTCATAGTT
GATATCAACGTCACAGACACCTGACCACTGACGCCTCCCGTTCGCATAATTACAATATCCATTGTCCCCACGTTCTCCATGACAGTCATCTGGGAATGCT
CGAAGGTCAAAATTCCAGCGTCGCCGTTATCATCAAATATGACTTCGCATAGGGTATTACTTAGACTGCTCGTTGTAGTGGAAACGAGGGCAAGATGTAA
CGACACAGCTTCTGATTCGTACTGCGAGTCATCAAACGTAAAACTGATAGTTTTCAGATACTCACCAGACTCAAAACTGATGTATCCTGGTAGTACAACG
AAAAACGATGTTTGTTGGTATAGAACTGGGAATGCAATAAATATCAAAGAATTTACCTGCGTTAGAGCCCTCATTATCAGCAGAACAAATCGCACCGCTA
GACGTCGGTGGGCAACTCCAATTTGACGCTATAGTCCCGGAACTTATTTGAAAATTAGTTTGGTCCAGAGTTGTTGTCCCAAATACTCGCAAAACGTTCA
CATCAATAGTTTCTCCTTCAACTCCACGATTGATCGTATCAACGAAACCAATCGAACCAGATCTACCATCGTCTACATCGTACGACTGGTTTATCCAAGA
GCTTGAACCTCCAGTCCCAACAGCCCTTGTAGACACCATGTACGTGAAACCATCTTGAGAAGCATTAATTCCACCTACTGTCAATGTAGCAGGGCAGTTG
TATGCTAAATCTACCATGGGGCAGTTCAATGAATCATGAAATACGGTCGCCTCAGTAGCAACACTAGCAGCTATCACTTCTAGCGAGAGCGAACTACCAC
CAGTAGATGACGGAGGAATCAATGCCAATTGAAGAGCTGTCTGAGTAGCATATAAAAACGTTGTGTTGGGGCTGGAAGGGATTCCAGATAGTGTCATAAA
ATCCATTGTTTCCCAGTCTCCCGATAGAGCAGAACTTTCAGCTCGAACTTTTACTTGATAGTTAGTCGACGCTTCCAAGTTGTTAACTTGTATCGAGCAG
CAGGTACCCCTTCCTTCAATAAATTCAGACTTGTCACCAACTTGGACTACGCGATAGGAGAGTGTAAGATCTCCAGGTGCCCCGCCATTGTCACATGGAA
GAGAAACAAGAAACTTCGCTGTCTGCATTCCCACATAGAATTCTGAAAGCGTCACAAGTTCTGGAGCAGTTGCAGCCGTGGTAGTAAATGAAGATGTTGC
TTGGTTCACAAACCCAGCCTCATTTTCAACCTCAATTGTATAGGTGTAATCTGTACTCTTTTGAAGGTTCCCACAATCAGTATAAGTTAGAGCCGAGTCA
GTGTCAAACAGTTCATTTCCATTCACGCTTAGTGACATTCGCACAATTGATGCACCACCTGTATCCTGATAAAGACAAAATAATGAGGACGAATTAATTT
TTGTTGGTCAACCGTCAGGTAGTTCATTTTTTACGTACCGCTGGAAGTGTCCATTTCAGTGTAATTGAACCTCCCGATGCAGACACACGATGCAATTGTG
GAACTCCTGGACGTCTGGCTTCACTAGTAGTCACCAAAATACTGTTTGAGTAAGGACTTTCCCCGACAATGTTCGTTGCGGATACAGCTATACTGTACGT
CGTTGCAAAATGCAGTCCTTCGATACGACAGATTCGAAATTGAGCTAACGCTGAACATGCCTTCGTTTCGGTGACTATAATGCCACACGTAGCCCCATCG
TTCAAACAGCAATTTCCACCACCACCACAAGCTGTCGCTGTACACGAGTTTGTCGCTGCATCGAGCAATTGGAAGGCACCGTTGGGATCCAAACTGTGAG
AGCACGTAGAGCAGCTAGACTCCTCAAGACATGAAAACAAGGATTGGATGCGTGCTGAGTATTGGAGAGACGTGACCGCAAAGCCACCGGTGTAGAATGG
TTCTGTAAATGATAAATCCACATATCCACCATCGATTCGGTACTGCATGACGCTAGTAGGAGGAAATGGTATTTCAGCGGCTAAGGTTGTAGCATTGATG
ACATTACCATCGTCCACACCTTCCAACCCGTATTGGTTGACAGGAACGACGGTAAACATGTACGTTGTTGTAGCTAGGAGCTTACCAACAAGAAATGAGG
TCTTGCTGGAATCACTTGATCCGTTGTAAACGAGTTCTTGAATTGCAGTGGACACAATGGCGCGCTGGTAAAGTAAATATCCTAAGGGTGCCACGACACA
AAAGGTAATGATAGTAAGTACTAACAACCTAGCAATAGCTACATAGAAATCACAGCAATACCTGAGATAGCCCCTCCTCCGGTATTCGCCGGTCCTTGCC
AATTTACAACCACCGAACTCGAACCAACATCAGCGACTTCAAGTAAACTCAATTTTTCTGGTAAACTTGGATCCTCTGTTGTAAATGTTAGTGGTTCTCC
AAATCCAGAGTCCCCGATGGTGGTGTTCAAGGCAGCTTTCACATAATAACTAGTATATGCTAACAGGTTTCGAACTGTGATCGCGCCAGGATACAATGTG
ACTCCAAAACTTTCGTGTAATACCCCAGTAGACAAGAAAACTCCAATAGTCATACCCGTAACATCAGTACCACCAAAATCATCGGGAGGTGTAGCAGTCA
CCAATGCAGTGCATCCTGACAATAGCAACAGCGTTGGGCGTAAAGGCGGAACCGGAACAGCAGCAACGTCCGTTATTGCATCCACAGCGTCACTTTCCAA
ACCATCACCTGACAATGTATCACAGACAATATCGGCTTGCATCGCTAGTGCTTTGAATGTGTACAAGGTGAGTGGAGATAGTGGATTTCCATCTGCATCA
CGCGTCACCGTAGTCGTTGTCTTTGCACTTGTAGTTAATGCCACAACAGTTTTCAACTTCACAAATGAATTTTCATGAAGAACAAACAGATTATACTGTG
CAATCGGAAGACCACCTATTCAAAACAAGAGCTGTGTCAAGATTCAACAGCGAATCCGTAGTGTGATACGTTTGAATTACCTGTATCTAGCGATTCCTCC
AGCACCAACGTTACTGATCCCCCTGTAACAACAACAAATGGTGAGACAGAATGTAAACCATAGCAATCCAAGGAGCCTATACCTGTTACACCTGCTACCA
TCGGCAGTGGTGTCTTGCTTGGACTTCCTCTGCTTCCAGTCCTTACTGAAATGGGGATATAATACGCGCTCTGAATGCCGCCCTTGCTGATCACACTGAG
ACGAAAGATGTAAACGGTGTTATGGTGCAGCTTGTAAATGGTTACTACCGCTCCGTTAAGGCGAAAAAAAGAATCTGTGAACGAGGTGAGTGAAGCCTCA
CGTTGCTGAATTACAATCGCAAAGGCATGCGCGTCAATAGCCGTAGTGGTCGTTTCATCTAGCACGAGTTTCACACTTCCACCAGATACGGATGATACAA
TGGGACGTTGTGGTACCTCAGGAGCATACTCATTGTAGAAACCTATCAAGGAGAGTGAATTGCTCTGAGGTCCGACACCCTGAGCATTTTCTGCCTGTAT
TGATATCAAAATGCTGCTCTGTATCTCGGCAACGTTTAAAGTCGCAGACAAAATTGCTCCATTTCCAGTGTCTGCAACTTTGACTCCATTCGAAAAGATT
AAATAGTTTAGTATTTCGGATCCTCCATCATCATCCACAGGACTCCATTGAATTTCAACAAACTCGGCTGACCGTTCCACGACATTGATATACTCAACTT
TCCCGGGGACTGTCATGTCTGAGGTATTAGCAAATAGAGACCTTGTGATATCATACTCATCACCATTTTCAACCACAAATTCAACCGAAATTTGGTAAGT
AGTAAGTGGGGAGAGACCACCAATACCAATGGGACCCTTACGATACACGCTTGCCGCATTTGGCGTACTGCTTGAACCGCACGTTCGGAGACTTCCATCG
TTGCAAGTTTTATCGCACATGTACGCGTTTGGAGTATCGTCAATTACTGATGAAAATAAACTGTAGTAGCAATTTCCATCTCCAGTAATTCCATAGTCGT
TGATTGGCCGCGTTTTCGTCACATTCACTTTCTGAACCATAAAGTCCACACCTTCTGGGTTTCCATCAGCTTCAGACGGGAACCAGTTCGTGTTCTCGGC
AGAATTGAAAGGAAGAACAAGAATCAAATCGGAATGGGCGATATTCTGCAGGAACGATGCATATATATCTGTAGAGTCACGAGCCACTTTCCAAATGCGA
ACCTAAAGCAATGAGTGAGCTGAGAACACATTACAAAATATTCCTACGTCAAGCACGATACCTCATCCATTGCGCCTTGCAACACAGATGTATCCGGTCG
AATGTTCATAGTGTCTGTACATGCACAATTGTGATCAAACGAAACCAACAGTACAACATCAACACGTAAGTAGCTACACTCGTACCTCGACCAAGTTGAA
GGTATGCGTATGTGGGCACATCGCAGTTGTTCTTGCTGAGAAGACCTTCCGCCATTTTTACTCCATTCATCAAAATTGTCACATTGTTGTTGGCACTAAA
TACAACTGCTAGGTGTGTCCACATGTGAATAGGAAGTCCATGTGGAACTCGAAGCTGGTTTTGACAGCGTGATATCACCAAATCACTATTAAGCGCAATG
CTGAAGCTTCCTTCAACAGTACCATAAAGTAGTAAAAGTTGTTGGTCGATGGAACTCGGACTCAACGTTTCCAAATAGACCCAGAGTTCGATTGTGCACG
CATCTTGAATCGGAAGAGAAATCATTTGAGCACTTCGCACAATTGATTCGGAAGTGAATTGGAGTTGAGTCTCGACAGCAGAACACAGCGTTCTACACTG
GCTCGGACTCTGAAACAATATTCCTGAACTATCTGTGCATGGATACATTGGTGTGATACCCTCACAACCAATATACTGAAGATCGTTACCTGTAATTAGC
GTACCAACAAAGGACAAATGCGTTAAAGGGTATGTGCGTGTAATGAAATGAAGATGGTACCTGTGAAACCGAGAGCTGGTCTGTCAGCACTTTCTGATCG
TTTTATATATGCGCGAAGTAGAACGGGAGCTTGGATGGATTTGGCAGTGTTGAGCTCGATGTAAATCATTCCACCAGTAGCACGAATAAATTCAATCTCA
CCAACTATACTCTCCTGTATGAAGTCTTGAAGCGAGATCGTTTTTAGGTATAGTGCGTCTTCCACTGACACCACACCACGAAAGATGATTTCAGCGGTTG
AGGCATATGGGAGATCAATCAACGTCTCAACATAGTTCCACGCGGTTTGAGAATTGACAGCAGAATCACTAGACCACACCTGTCGAGTTTCCGTTGAATT
CAACACAACGTCTGTACTGATACTCGAGAAGTCTGTCCAAATGAAGAAATTCCTCAACAAATTTCTGAAAGCAGAAGTAAACAATTAAGCGACGCACCTG
AAGACATACGATACCTGAACGATAGAGCGGAGTTTCCTAGTAGTTTTGTCGGTAGACTTCTGTAAACAGTCTTGCCTCCAGCATCTGGTTCGATCAATGA
GTTAGCGATCGGGATCCATTCGACATCCACTTCACGAATCGTCGATAATTCGACACCTAATTCTTCAAAAGGAACTATACTGTCCAGTATGCTAATTGCT
GAGACGTCAATGGCAAAATGTAGTGTTCCCGCGAAATTACTGTCTGGGGTAACAGAAATTATCACGCTTCTCTCAATATCCATATCGTCGTCGTGTTGGA
CGAGTAAATAGTAGCGTTGGTCCTCTGAAGCAGCACATTCAATACCATCACGTTTGATGATAATGACATCGTTTGTCGTATTCACCGTTACCGCGAGGGT
AATGTATTCAATATCCGGAATCGTAGTTGCCATCAAGGGAATGGTTATTTGAGCTGTTGACCCTTGAAGAACAGTTCGACTGAAAGAGTAAGGAATAGCG
AATACAGGCTGGGAAAATGAAGGAAGCACTGATATCACGAAATTCTGCACAAACGAGCATCCAGAGTCCACGTTTGCTGAGTATTTCCAGTCCAAAATCA
CATCAACGAGAAAAGACTCAAATTTAGAAGGGATGAACGAATATCGGTCTGTGCTACCTGCGTTCAAGATAAAAACTGAAGTCGTGGAATTATAGGACTC
CCATGGTACAGGATCATTGTCGATCGAGATGATGCCCACATTAAGCAGCAATGTATTATCCACAACAAAAGAAATACTGTGTGCATCGTGGGGACTTGAA
CCAAGAATCGTTTGTGCAAGCGATGTGAGATTAACATCACTCTTCTCATCCTTACGCAAAATAAGAGGACCACCATTAGCCTCCCTTAACTCGCAAAATT
TGAGATTATAAGAAATCAGAATGGATGAACTGATTGTCCAAGTAGTATCACCAACCCCTTGTGCGTAACGAGATAATTTCACTTCAATAGCAAGCGGAGT
AGCTTGACCATCACGTTCAGCTATGGTAATCCCACTGAAAGGAACGGATTCGCTTGAGCTGCTGTCTTTCAGTAGAAACGTGCATTCCTGACTCATCGAA
CGGGAAGAACCCACAGTTATGATATTAAATGAAGAACAGTTCTTGACTTGGATTTCCACACTGACATCAGTCAAGGCGTTTGAGTAGTTTAGTATCAGTT
CCAAAATTTCACCCGCCAGTACGTTATGAGCGCCAAGAAGAATTTGGCTTGGGATCGATACATCGACACGAGGAAGCACGCTCCAAGTGAGTGGAATGCT
AGATGCAGCTAACACATTATCATCGGCATCCATACTCACAACGCTTATCTGGACCTGAACACTATTTACATTTGGTAGTAACGTGACCAACAAAGGCTCA
TCGCATAGATGTTGCAGTGCTGGGTTGTGAGTGCCGGCGTATTGGACGCCTATTGATGAAGCTTCCAAGGTGTTAATGACGTTTACCAGCGAGAAAACCA
CGAATCTCGTCTCACAATATACAGAGCTCGTTTGTGTGGCGGTAGGAAGATAATCAGTTGCCAAAAGACGAAGTGGGTCATTTACTTGAAGGTCGACAAC
CAAGGGGGAAAATTCCACCACGTCAGCGTTAGAATTTGATAAATCGTCGAGTCGGCGGGTTCCATTCGCGGTAATTCCATGTCCAGCTCCCGTGTCGTTG
GTACCTGAGCGCGCTACTTGAATTTCTGGCTGCGAATTAATATCGATAATGAAATCCGTAGATTCATTCTCGACGGCCACGAAAAATTTCTTGGAGTACT
GAATCATTTTTCCTTCCGTTGTGACGCCAACTGTGATTAGAAATTCGCTTTCACCAACAAAATCTGGCAGAATAAAGACCTTCAGCGACGCATCACGGCG
CCGAACTCTCCAACTCGTCAGTATCATCCCATTTCCCACTTGTTCCTTCGATGAGGCACTACCAATTCGTGCGTATTCAAATTCTCTCGAAGCGTTCCAC
CTTGTTGCTACCGACACGAGGTCAAACCTTTCATTTTCCCCTTTTGCTTGCTTGATATCTTCCATAACATCCTGTAGTCGAACCTCAATGAATTTGTTGG
ATGGAACTAACAACACGTGAGCACTTAGTAATATAACACCTAAAGGAAAATCTGATGCTGTAGTTTGCTGAAGGTGAGCACGACCAACGACATTAGGAAA
TGATGAAAGAGAGCGTGGCACGAATCTCGATGGTCGTTTCACCTCCGACAGACGTCGAAATGCTGGTGTGGTGGGCGACTTAGCTGCTACAATTGGTTCA
CTGCCGTCCTCCGCCAAGAAAAGTAGATCAGAGCTCGTTTGCAGATCAGCATGGTATCCACAACGCCCCACAGAATCATACAAACATTGACTTAGTGCAG
CACCTGTAAGAACATCTTCACGTCAGTCAAAATCGATCATATACTACCAGCAAATTACTGACCATTCAGAAATTCCGTCACCGGAACAAACCACAGCGCT
ACGATACCCGTGCTCGTTGTGTCTTCGTTGCGCACAAACGTAATTGGTCCTGGAGTCGGGGGAGAAAATATCGTAGGTAGAAAGTCATTCACCGCTGTCT
GGACTTCGAAAATCCGCAGCGATATCCTAGCTGCAGCTTCAATCTTCATCACAATGTTAGTACACTGGCATATCGACATATCCGGAAGCCTCAAGCACTT
TACCTTGATAGATTTCACCACAGCTTCATTATCCAACGGAAGGGTGATCTTTGAAACCTTTTTCTTGAGACTTTCACTCGAGAATTCGACCGTCTTCAGC
ACAACTTGATCATCTCCATACAAACTCACAACAAGGGAGTCGGACGATGCAGTTGACGAACTGCGATCTGTAACGAGGTACAAGTCCACAACTACAGAAA
AGTTTGTTAGATCGAGCGCATGCTAGGAATGTAGACAGTTGACACACCATTACAGAGATCCCAAGTTCGGTCCTGAAGACCGTCAGCACAGGAATCAGAG
GGGTCCACTGCACACCCGAAGGAGGAACTGGCATTCGTCTGATAGCAAGTTACTGGTGTGCTGGTGTCTGTTAATCGCGTGGGTTGGCACATGCAGCCTG
ATCGAGAAAGGACTTGGGCCATTGCGGTGCAGCACGCCAGCACCACCGACAGCAAAAGGCACAGGAGCATTCTTCGCAGCAGCCTCTCATAGCCAGTCTG
GCCCAGCATTAGTCTGCGTATGTGTCGCTCAGCGAGTCACTGAAGTTGACGCCTCAAAGG