Description :
From Genome Similarity Track
Location :
Scaffold_913:7554- 11173
Transcript NameFunction/comments
g7314.t1hypothetical protein
g7315.t1XP_009536753.1 hypothetical protein PHYSODRAFT_319165 [Phytophthora sojae

Sequence
3619 bases(100 bases per row)
CGCATGCGTCTATCTCACATTTTCGTGGTGATCGCGGCTACTTTCCTGCTTGCCAGCGCGACGCCCACGGACTCCAACCAAGCCAAGATCTCCCAAGCGA
GTTTGCCGGAAGGCCCGAGCCAGCGGCTTCTGAGGACCCACCCCACGACCTACGAAGACGACGATTTCGAAGAAAGAGCAGGAGGTCTGAGTACCTTAGA
AAAACTGAAGTTTAAAAGCATGAAGGGCAAAGGCAAGACCCAGCAGGATTACGCAGCCAAGTTGGGAATTGCCCAAACGTTGAGACTGGCGGAGACTGAC
AGAGCGGTTATGAACCAGCTCATGGCGTCGGAGGAGTATTTTAAGTGGGTCAAATACTTCAACTATTTGCAGAGCAAGAAGTAGACGAAGTCTGTACAGA
CCAAACACGCTACCGCTGCAAGAGTCTGGCCTCGAACCAGTTGCAGATAGATTGTAAACTGACGATTAACCCTTTTAATAGAGTGTCTATCATCAGAAAA
CATGGATATCTCGCATCTAGTGCGTGGCATTTGTGGAGCCAGCATTTAATACAGGTGGCTTGGGACCAAAAAGGCAACACTGCTGTGACACCATAACCAT
CTCCTCAGGGAGCAAGTATCATGCAATTTCAAACTTGTTTACACTCATTTACGAGAGGCGGTCGTGGGCACCAAGGAATGGGACTACAGCACCGCAAAAT
CAGAACCGAGCACCAAATTCAAAAGGGGGCTTAAGCACCGCAATATTTAAACTTCAGTACCATCGATGCGGACGCCAGGGCCGTCGCGATTTATAAAGAT
ACATGTAGCTCAACTTGGCAGACTGCCGATTTACCAGGGCACAAAGCGGCAGCCTATCGATTTACACGGGTTGCACAACGCGGCAGTATGTCAACTTGTA
CACATACTAGGTGAAGCGTGCTAGCTGCTCTCATTGAGCTGGCTGCCGGCCGTCGACATATCACACAAAAATCGGGATGGAACCCTACCAAAACACTGGC
AATCAATTTACCGCACGGCTCACAACGTGCACTCGAATTATTACACTGGCATCTGCGAATCCACAATCAGCGCATCGCCGTGACGGAAGGCCTGCCGCGA
AGTATGTCGTCGTAGGCACTGTATTTCCGAACTTGAACGCAGACAACCCGCCGGCGCAACTCTGGTACCGGTACTCGACGATCCCGTCGTTCTCGATTGA
CTTTGTGTGGGATCACTGCTCCTAACGGAGAAGTACGAATTAAATGGAGCGATTCCCGCACCGCATCAAGGTCTGTCCCGCATCAAGCTCAAGACTCTAG
ACTGCCCACCACGGATGCGGAGGTGGACACAGAGGCCGGGCGACAGCAGCGGAGCGAGCAGGAGCTGGGAATTCTCAACTTGGAGGCGCGTAGACAGACC
TATTCTAGCCTTTTGAGCTGTTATCACCTACCACAAGCATCATGACAAGTCGCGGGAGGGTCGCAGGTGTCGAGAATTAGAGCCACCAGGATGTGGACGC
CCTCCTGGAGTTCATTAGTGATGTTCTGCCGACGGGTGCGAATGAATGGGCGTCAGTGCGGCTGAACTTCACTAAGGGCAATTGTTAGTCGATTGATGAC
TATGACTACTGTACCCGACTCGAATCTATTGTTTTTATACTAAAAACGCCACCATAGCGCCAGCAGCGCTCACGCCCGAGGTGCTGGTCGCCCATGTTCT
GCTGGATAGTTGATTTTCAAGTGGGGGCTTACCGTCCCAACAGGTCGGCCACACTATTGCTCACACCACCGAATACGCTGAAATCTCCTTGGACAAGTCC
GCCACGACGATCAGATTTTGCTGGGTCGTGGTGATAGCGTTGGGGCTGTCGTTCAGAGCAAACTCTGTCACGAGGAACGGATTCGGCACCGTAGGGTCGT
CGTCGTCGTTCCCGTCGCTGGGCGCGTCGAGGCAGAGTGCTGCCTGGTAATCCCACACACACACCTTGGCGTCGTTGGCAGTGGACACAAGCCTGTCCTG
GGGGCCGAACGCAGGGAAGTGGGCCTGAGAAACCATCGCACCATGGCGCTTTAGTCGACGCACGACCTGCTTGGAACCAAAGTCAATGACTGCAATGCTG
GCATCTCCCAGACCAGCCGCAAACGACTTGCCATTTGGTGCAAATGCTAGCGAGTGCACCAGCGGCGGATTGAACATTTGCTGGACACCGGATCCTTCTC
TTTCAGCAGCCGCACCCAATCCATTCACGCCAGTGTTAAGATCAATACTAAACTTTACGCGACCCCGGGAGAAGTCCCAGAAGAGGAGCAGGCCGTCCAT
ACCACCAGAGACGAGATCCCACGGAGCATTAGGGCGGAACGGAGCAACGCTGCAAATGTTGGAGTGCTGGCCGCGCAGGGTCTTGAATAGGCGGTGGTTT
TCCAAGTCGTACACGCAAATATCTCCTGTGTCGTCCGGTGCCGACAAGTACTTGCCGTTCTTACCCGCGTGCCGCGACAACACGTTGATCTCGTCCTCGT
TCTGCTGGAACACTTCTCGGTCCGCGCAGTCCACGATCAGTGCAGGCTGTCGCACGTCGAAAGTCAGCACCTTGGTGCCCGCTGCCGCATAGATGTAAGC
GCTCTCTGCGCCTGCAGTGGCCCTGCCGAACGCTAGCGAGTTCACCGCGCTCTCGTCTTCGTCGGTGGTACCCAGCGCCTTCTTGACGTTCAGGCATTTA
GTCACTCGCGTGGTGCGCACGTCCCACAAACGGCACGTGCCGTCGTCGCTGCCAGACGCGAGCACATTCGGGTGCACGTCCTCCTCGCAAAGAAGCGTGT
TCACCGACTCGCGGTGGCCCTTGAACGTCAGCACCCGAGGTGTCACTGCCATTGTTGTCCAGAAGCAATGTCAACCTGCCGTTTCTGTACTAATTTGTAC
CCTAGTTTTGGTACAGTATGCTACTGCCACCACGTGCTGCCCCGTTGGTGAAGCCTCTCGATCCGAGCCCTTACACCGCGACATACGCGAGTGGCACCTT
TGCTTCACGGTGGGGCCCCCACCTGAAGACGAGATATTCCTTACGAAAGTTGTGCGTCTGCTGCACCCGTCAAACGATTTTCGGTGCCGCGGGGAGGATG
GTCAACACACCGCAACAGCATCTGGGCATGAGCTTCAGCTATGCCTGGCGGGCCGCTCTCAGAACTTATGCCAGTCTCGCTATGTATTAGAGCCTCATGA
CGGACTGCTGAAAGCTCCATCGCGATGGAGGAGGGGGGAGCTGCAAAGCCTGTTTCTATGAGTGCCTCATTAACCACCATGTTGTTGCCGCCTTACTGCT
GCGCGGACGACGGAACCTCCCAAGTGCCACCGGCGACCGATGCCCTGGGTCGCTGCTGCAGCTCTTTGCTAAGTCGGTGGCTGGCGGTAGGCGATTGTTC
CGCAGTTTGCGCCCTGCTTGTTCATGTACCGACAGGAACAACACGTACGATTTGGTGTGCAAAGAGAGCGGCCGGCATGCAAGTGCATACTGCGGTGGTC
GACGCACTCATCCACGGGTTACGAGTCGCCGCGGCTCTGGCAGGCAGACTCTGCCGCAGAGAGGTTAAACGATTGTGTGACTGCAACTGTAGTCACGTGC
ACAGCAGCGGCGATGACGC