Description :
From Genome Similarity Track
Location :
Scaffold_571:7554- 9280
Sequence
1726 bases(100 bases per row)
NNNNNNNNNNGAGATATCCATACAAAGCATTATCAACCAAACGCTGATAAAACTGTGGAGCTTTTTCCGGTCCAAATTGCATCCTCAACCATTCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTGATCACGACTATTGGTGAAGCCCACGGCGATGTCGAAGGTCGGATAATCTTAGCCGACAACAGGCTT
TTTATCAGATTAGCCAAATTCTCACGAAATTTCGGTNNNNNNNNNNCGCACACGCTGCACTATCGGCCTCGTCTCCAATATCAATATCACATATGGCCCG
CGTGCTGCAGGGGGTAACGCATTTCCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCATGTGCTGCTCCACATTTTCCGCAAACAATTTCGCCTCATTCATGTTAATATATCGATGCAGCCGG
TATATCTTCTTNNNNNNNNNNTCCACATCTTCCGTAAACACTTTGCCTCCTTCGTAATAATATATTGATGCAGTCAGCATATCTTCTTTCATCATCTCCT
CGTCTATTGCATCAGCANNNNNNNNNNCGCAGTAGCCTCTGCACTATCGACCAATCGTGTGGGCTGGCCATGCACTTCCCGATACTCGTCCTTGTAGCGG
ATAAGTTGTCACATGGTTGACCACCTGTGTTATGTCCCTCTTTGCAACCCCGCCTACTTCACTCGACTGTTCTGGGGTCTCCCGCACTGCGTTAACCGCA
CGCGATGCCTTCTTCGATCTACCGTCCTTGCCTTCGTTAATCTTCCCACTNNNNNNNNNNCGATGTACCATCATGGCCTTTGTTAATCTTCCCACTCGTA
TACTCGTCTTCATTCTCATCATTATTGTTACAATCAGGTTTAGATCGTGATATGATCCCCGCAAAAACCTTGACGTCTTCTGATTCCTACTTTGGTCAAG
TTAAAATTCGGGTGGGTTTCTCGNNNNNNNNNNATGATCCACTAGAAGTCCCGCATATGCTTCAATATCTTCTTCTCCTCGATCTGTAGTAGCTTCAAAG
GCCAATATTTGCCATTCTTATACCGCCGCGATCCGACGGATACATATTCCTGAGATCGCGGTATCATTTCTTCTGTCATCCACAACGCTAAAGAGGCCCC
ATAATTTAAGATCAAGTTGCGATCGACTATAATCGTAAGCTGCAAGAACTTAAACATTCCGGGACCATTTGTCACGGTAGAAATCCACGCCACATCTCGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTTGATCGCCGATATATTCGATCGGTATGGCGGTCTCTGCCCAGCCAAACAAATGCGAACTTCGTCTGGTAGACACAGGGTTCCGTCTATCAAATCCAG
CCAGATGCCTGCCGGAACCATGAAGT