Description :
From Genome Similarity Track
Location :
Scaffold_1:755358- 772104
Transcript NameFunction/comments
Phyra_72798phosphatidylinositol kinase putative
Phyra_72799Hypothetical protein
Phyra_72800nucleoredoxin, putative
Phyra_72801conserved unknown protein
Phyra_72802PREDICTED: LOW QUALITY PROTEIN: zonadhesin
Phyra_72803protein kinase, putative
Phyra_72804Hypothetical protein
Phyra_71042glucose regulated protein /BiP

Sequence
16746 bases(100 bases per row)
GCTCGATAGCCACATCACGCATTATCCATCTCACTCCATTCTGCGGCTGCCGACTTTCGTCGCTGCTTGAGCGGCGGCTCTTTCTCTTCGGCCTCAGCCT
TCCCGTCCTCCGCCGACGCCTCCTCGTCCTTGGCCGTCACTGCCACGCTCTTCCTCTTCAGACTCTTCCGAGTCTCTGCCGCTGCCGCGCGCTTGTCGAT
CTGAAACTCAAAACCCACAGGCGTCGTGAGCTTCGTGCGTCGCACCGCCGGGACGCCCACACCTCCACTGGCTGAAAGGGCTTGGGAGAACAGGTCGCTC
TTTCCAGGTGCAGATCCGTGCGTTGTAGCGTCATGATATTTCTGCGTCTTGCGCTTCTGGGACTGTATGCGCTTGCGGATGGCCGCAATCTCCAGCAGCT
CACGGGACGTCCTCGTCAACATGTCGGCGCGTGAGCGGGGTGCGGCCTTTTTCATCTTGTGAAACTTGGGCGACTTGGGGATCGTCAAACGGCCGTTCTC
CTTGGCCACACGCGCCAGCCGACGCCGCTTACGTGTCACCTCGCGCGCCTCTGCCAACTCCTTCTCCTTCCCAGTCAGCGCTTTCGCCCTTGAGCCTGCT
AGCGACGCTTTCGTGGGCCTTAGGAGACGATCGGTGGACGAAATCGCGCGCACTCGAGTCACGGGAGCGGCCACACCACGAAACAGCGCGTCCGGGTCTT
GGTCATACACGGGGCGCGTCGTGGGCGCCATGATAAGGGGCAAGAACGTCAACTAGGAGCTCGGAGACTTGTCTTGAACTGGAAAGCGGGAGAGCATACA
AAGACCAAGTCTTGTGGAAGTGCTCGCCTTTTTTGCCATTCAAAATTCAAATAGAGTATTGTCCAATCAAAATAATGCTGGAAATATCCACCAATAGGAG
AGAGAGACTATTTTTTGTTGAAGACATCGTGCACCAGACCATGCGGCCGATGCCCCCAGCTCGGTCTCGCCGAGCTGTGTCGCTTCAGCAGGACAATGTC
GACGCGTCTACTGCAGTGCAGGTGCTGCACGTGTCTATCCCGCTCAAAGCGCAGCACACGCCGGCTGCTCTGCCGCCCCGACTGACTCAAGCAGTCAAAG
ATGAGTTCGCCATCCGCTACTTGCAGCAGATTGACGCCAACTCCACTCCGCAGAACATTGCAATGGTGTTGCAATATTTGCCACTGGAGAAATGTGCTGT
GTCCGCAGCCTGGAAATCGCGTGGATCTCTGGCCGATATGTTGGCCATTGACTTGAATCCGAAAGCTCTGACTCAAGTGGGGGCAACTCCATTGAAAACT
GAAGCTCGGGGTACTAAACAGTATGAGCCAACGGGGATCGAGGCACAACAGCTATCGCCGAGGCGTCAGCTGCGCGGCCAGCAATCTCGGTACGTGTATC
GAATTGGCACGGTGTGCTTCACATTCGACGACATGAAGCGCAAGTTCTTGCTGCCGTTCAAGCTGGCGACACCACCGCCCGAGCCTGACGTGCTACAACT
TTATGGTACTCGTTTGGAGGTTGATGCAGGTTTGACGCCGAACCAAACGTCGCATTTCAGGGACCCGAGCGCAGTGCCGGGTACAACAACAGCTCAAGGA
ACTGTCGGCAGATGGGAGACGCAGAGACGACTCAAATCTGTAGACGAACGCACCGTACCGCCGAACCCAAGCACAGAAACCGTGTCCGAAATGCACCATG
AGTTCTACCTTACTCTGCCATTGACGTCACTAGGTCTGCCCGAGGGTGCTGAGCACACGCGTACCGTGCTTTACGAAACCCTGCTCAGCCCCGCCATGGT
AGAACTCGTCCAGAGCACTGTGCGTTACCTCTTCCTCACTGTAATACACTCCCCCACCACAGCCAGGGAGACGATACTGAGCAGGCATAACCAAGATGCA
CTCTTCGTCTCCATTGTGCAGCGCTTTGCCATGCTTCGAGCTAAAATGGAGCGCAAAGAGCATTCAACACCTCGACCTCAACTTGCCGTGCTCGTGCCGC
TACTGCTGCTCGCTCTTCGCGTAGACGTCGAGACACTAGTGCGTTTGCAGTATCCGACGAGCTTCTCGTGTGTTTCGGAAGAAATGGATCGAATGCTGCA
AGTCATCGACGCCAGGATCTCGCAGCTCTTAGACCCAGACGCCAACTGGAGTCGTCTAGCCGTGCTGGAGACGACGCACGAGGCAGGTCAGGCCCGAGCA
TCATCCAGCTTCCAGCGCGATCGTCGGCATCGTCGCCTTCGAGACCAATTCTTCCAGACGAGCGCAGTGCTGCACGGCCTCTTCCCAGAGCCTTCATCTG
GCAATTGTCGCCGCGTCATGACACTGCGTGGCGGTGCCGGGATCGGCCATTACCCAGAGCTCTCCAGCGCTCCTCCACAAACTACCTGCTTCACACCTTC
ATCACCTGCACCCAAGCAGGACGAGCGTCGTCTTCCAGACAAGTCCAGCTACAACCACAAGAACGTCGTACCCGTCTCCATCACCTCCAAACTTTCCCTT
CTTCGAAGCCTCCGCCGCTCGCAGATATCCTAAATCTTGCATAAGTAACAGCACCCTCAACAACGAACTGAATCATAGCAAATGGACATGAATTTCTTTC
AAGAAGAAGTAGGAGAAGGCAACTAATGCACTCCAGTCGGCCGTCAACTGACCGCGTCAGAGCAGAGCCGCAGCTTCTTTACTTCGTGAGCTGCTCCCAG
AGTGCCTCCACGTCGCCACGCGAGTTGGCGACGACGGTGCGGCCATCCATGGTGATGACCTTGCCCTCGCTGTCCACAAAAACCAGCATGGGGATGCCCG
TGACGCCGAACTTGGTGCTCAAAGCCTGGCTGGCGGTGCGCTCCTCGAAGGGCAGCGCCAGGAACGGCATCTCGCCGAAGTACTCGCTGTACTGGGCTGG
GTCGCGGTCCGACGAGACGAAGATGAGCTCGAACTCCGGGTGCTCCTCGATCATGTCGTCGTACACGGCGCTCAGGAAGGGCGTGAACTGGCGGCACGGC
GGGCACCAGTGCGCACTGAAGTAGAAGCCCACCACCTTCTTGCCGGCCAGCTTGTAGTCCGTGTCCTGCAGGCCGTCCTTCGTCAGGAGCTTGGCGCCGA
GCTGTTCCGACCACTTCATGGCTTTTGTATAGTGTTCTCTGGTTTGGGGGCTGGACAGCGAGAGAGAAAATGAGGAGACGATTGCCGATATCCAAGTGGG
ACTGGAACGGACACAATAGTTTGATGCTACCGAGAAAATCACGATAGACCGCCTTGTGAAAGCGAGTAAAGCTGCGACTTTTTGCCACGTGGATCCACTA
CGTAATCATGGGTCGGAACAGTACCGTGGGGGACACCAATTGTTGTGCATGTACGAAAAATAGAAATGTCGCTTCTGTCTACATGGAGGTGTCGCTACGA
GCAATCTAGCAAGAGCAATATCCTCCGCGCGACGTGCAATTCTCATTGAGCATCCTGTTCTGTATGTTGCACCTCTCCATCTACTCCTCCGCGGTCGCCC
CTTGCTTCTTGGCGTTCTCGCGCGCCAGCTTCTTGGTCAGGTGGCGGTTCAGCGGCTTCTTGGACGGGTCAAACTCGCGCAGTATCACCGTCAGGTGCGT
GTGCGGGTGGTGCATCACACCCGAACGTCCTGCAACATCAAAATCAATCAACGTTAGTCAATCTCTGCTCACAGTCCAACTACAGTCTCAACGCACCTCG
GCCCATGATCCGCAGACGCTTGAGGAAGGTGCCCTTGTTCACGAAGCACTCGGACACCATGAGGTTCTCCGGCTCAATCTGGTACTTGATGTCAGCCAGG
TTGATGGCGTTCTGCACCGTCTTCTGGAAGATCTCGGCCTTGCGCTTGGGCGAGAACTTCATCTGCAAAATGGCCTCGCTGGCCGAAAGCCCACGGATCT
GCTGCGCCAGATACGAGAGTTTGCGGGGGCTGGCGCGGATGGCACGCTTCACCGTCTTAACGGTGCGCGACTCGGCGGGGGACGTGGAGCTTAGGAACGC
GGCCGTGTCGTCGTCCGCAGCGCCCTCCACGACGGTCGTGGACATCTTCGCCCGGGCGGCGCGCCCTACGAAAGCGCTACCGGCGGCCGGGCGGAGCGCC
AGCGCGCCCATCTGCGAACGCAATGAAGCAAGCATCTTGTGAGTTGTGGAGAGCAACGGCCTCTTTGCTGCCACACGACTAGGAGCTGGCGAAAATGATA
GACAGCTTCATCTATTTGGAGAGGTTATAGAATACGAACACGTATCAGTTATGGTTCACTAAATTGAACACATGGCTACATAGGTTGCCATGCTGTTGCT
TATTCAAATCGAAGCTCTACAAAAGGCTGTCTCTACTAGTAGCTAAACTACGCTCGCTAGGTTGGGGTCGCGGCAGGACGTGATATACGTGACTTGAGTG
TCGTCAGTGCCTGGTCCCTTTCTCGAAGACGTGCTCGACTTGCCAGCTTGGCCTGCTTGTCTCCACGTCACCACATGCACATATCCCCATCGGGCGTCTC
ACGCAAAAGGCGACGTGGTGCGGGTCTTTTTGTCGGAAATCCAGATGCGCAGCTTCTCTAAGTTATCATGGACATCGTCCGAACCTTCCTCGTCACCGCT
GGCATACGCGCCGGCACTCATTCGATCCACGCTTGCACGACCTGCAGCATTCACATGGTCCGCATCGTCCGGTAGCCACTCAATGTTCACCTCGATATCG
GTTCGGTTAGACACGAGCGGCATGAGGTACGACACGAATCGCTGGCGAGACGCCGGCGGGAGGGACGGGATCTCGATCCCTCGTACTGTGATCTTGGCTG
CTGACGTTCCCACTACAATATTGGCAATCCACTCGCCCAGGTACTCGAACTTGTCCGGTCGTCCCTTACAGATATCGCGGCGAAGCGATAGGAGGAACTC
GGGCGTGAAATGCTTACACTTCTTCTGTAGCTTATACTGCACAATGGCCTCGCTGAGCGCCTGCATTTGCTCTGTGTTCTCCATGCCGTGTGTACCCAAG
TCGTAGCACTCGCTGCACAGGTTGTAGTTTGAACATACGCTACAAGTCCATAGCGCACCAGCGATAGGATCCATGCCGCAGCCATCGCAGAAAGAGTTCG
CATGTACGATCGTTTTCTTGCGTTTCCACTTCGAACCGATAATAGATGCTCCCTGACTCATAGCTGCACCCAGCCGACCCATAAGCGGCTTCGCAGGCGA
GTTCTTCTTGTCAGGCAGACTCTTGGACTGTGAGTCCTTGTCGTGCACGTCACGCTGGAATACCAGCGTACGCGGAACAGTAGACGTTTGAATGATCTCG
AACACCTGCTCCTTGGTCATGTGCGGCTCAATAGTTTGCCCATTCACGGTGATAAGATAATCGCCCACAACAACGCCTGCACGCTGCGCAGGACTGTCCT
TCTCCACACTCCAAACCTCAACCAGTAGTTCATTCTCCAGCGACACTACGACGTTCGTGTTAAAGCCCAGCACAGGCTCCGTGAAGGTCAAAGCGTACGT
GTTGAGCGGATGCTCCATGTAGTCCGCTTCAGATTGCGAGCGCAGCCCAGACTTTGCATCAGGTGCATGTGAATGACTTGCGCTCGACGAATTACGCCCA
GACGATTCGCCACTGCTCGTCAAACTACCCGAGCTCGCCGGAACGACTGGTGCCTCACTCGAGAAGCGAGGCGGCTTGTCATGGAGAGCAACATGTCGTA
TGCTGTGCAGCGCGCGAACTGACGACGAATCAGAAGCCACGCTTGGGCCCAAGAAGCGATGCGATGCAAAATCGTCTTGTCCCTCACCAAAGTCCGCAGC
ACCGCCATAGCCTAACGGCGTGCCCAGGTCCGCACCTTCCTCAGCTTCACCTGCAGTTCCACCTGCAGTTCCACCCTCTTCTTCGTCACTGTCGCTTGTC
TCGTCATCAATATCGTGTTGCACAAGGTTCAATGGCGCCGGGCGCTTCGGCGAAGGAATCACCAATTCGACTTCGTGAGTCTGAACCCCCACTCCATAAT
CCTGTTGTATCTGCATCTTTTCCTCTTCTTTGATCGCGGCAGGCATAGCAACAGGAGACAGCGGCTGCATCAACTCCTGAGCCACGTCGGCAACCTGCTC
CTCCTCCTGGAAACTCTGTTCAATAGGATATTCACCCACTGGTGTTGTAGGTTCCTCCTGCTCTTCAACAGGCATCGTAGGCTGCTCCACCGGCGCCGTA
GGCTGCCCAACCGGCGTTGTAGGCTGCTCTTTAGGAGTCGCAGGCTCCTCTTGCTCTACAGGCGTCGTAGGCTGCTGCACCGGTGTTGTGGACTGCTCTA
CGGGAGTCGTAGGCTGCTCAACCGGGGTTGTAGGCTGCTCTATCGGAGTCGCAGGATCCTCTTGCTCTACAGGCGTCGTAGGATGCTCTTCAGACGCCGT
AGGCCGCTCAACTTGAGTCGTGGGTTGCTCCACTGGCTCTACCGGCATGTTATGCTGTTCCACCGGAGTCGCGGACTTCTCTTGCAGCTCTACAGGACTC
GACGGCTGCTTTACGGGTTCCTCCTCGTCATCATCGCTGTCTGTGCGCGCCTTGTCCGACTCAGTTCCATCCTCGTGGGTCTTGTGCAGCTCTCGCTCCG
CCGCTGGGCTCTTCTCCGTCTCCACCTCCGCCACGTCGCTCTCGCTTTGCTTCGTGGGGGTGGACGGGCTCACGTCTGCGCCTGTGGGCATAACTGTATC
CCGCGGCGACTCCGCGTGGGGCTTCACGGGCGACGCGCTCTCTGCTACATCCGTGGGCACCTCCATCTCTGCCCTCTGCCCCTTGTAACGTATTGTGAGG
GCGATCGTCCCTTTGCTGAAAAATTCATCGACTATCTTTTCAGATAATCGATGAATGTTTCCACCGAGAAAACGGATACTCTCAACGTGCGTATATCAGC
GAAAACAAACGAACAGAGGCTTGCCCAGCATATACACAGCCTGACTTTCATATGTGCTAGTCCTGTCAGACTGAAATTTATCGGGTTTGGAAGACTCTTA
CTTGAACATTTTCAGTAAAACCATCGTTTTGACCACTTTTCCTCATGTCCAAGCCAAGCTCAGCATATGGTTGATATCGCATGGCGGCGAGCGACCACGT
CAATTCGAACGGCACCGCATGGGTGTCTGATTGCCCCCGACTATGCGGCTCACGATCGATTGTGTCTCGGCAACCAACTGCAAAAACAGCGATAATGAAA
GCAGAAGCGTGCTGCATTGGATCCACCCACACAAGAAGCAGCACGAATTGCAGTGACTAACGCCATGGGACTTAAATGAAAGCTGCACTTGGGCAAAGTC
GCCGCTCGCGCCACGTCACAGATCGCAATTCCCTCCAATCGCAAGGCCGCATTTCGAACCGAGTACCAGGTCAACTTCAACTTGTTTTTGCAGAGCTTTT
CCGGGTGCACCCTCCGTTTGCCCTGATTTCCATCGCATGTAACTTTGGGACCTCCACTACGTCCGTAAGTACCCTTTAGAGCACGTCTCAACCCGTGTTT
TGCTGCATCAAGGCGCAGAACTCGTCGTAGTCGATTTTCCCGTCCTCGTTCTTATCTGCTGCTTCGATGATCTTGCAGATTTCGTCGCTGCTGATGTGCT
TGTTGCCGAGCAGATGAAGAATGTGTGCGAGCTCGCTGCTGCAGATGAACCCGTCATGGTTAGCGTCGAAAGTCTGTGCAAGGCAGCAAGTTGCAACCTG
TAAGTGCAAGCTCCATAGTAATCAGCGGGCTTGTCAACCGTACATCGAAAGCTGCTTTAAGATCTCCAGTCGTCAGATCGCCACTAACAAATGAGTGTAG
GTTAGACATTTCTTCTCAAGCCATGAATAAAGGAAAAGACTACACGAACCGACGGAATAGTCGCTGATTCATCATGCTCACGAATTCTGTAAACGAGATC
TTGCCGTCACCGTCCGTGTCCGCTTGCCGCATGATATCGTCGACCTCAGAGCTACGGATACACAGTGCCAATATTCAGTCAGCATAGAGAAATAAAAATA
TAAACATAAACAGATAACAGCGCTCAGTTAACCTGGAAAGCTGCTGCCCGAGGGCCAACAGCATACTCTTCAGCTCATTTCGATCAATACAGCCAGATTC
GTCTTTGTCAAACAGCGCAAACGTTTCCTTGAACATGTCCATGTTGACGGTTGACGTCCGATGTGACACAAGCTGCTTTTCGTCAGTTTTCTCAAATTTC
ACGTGCTGCACACCCATAATGACTGCCAAGATGTTGGCGCGAAGCCGTTGCAGACGCTGGTAGGATAGTAGTCGCTGAGTGTGACCGCTATCAAGAGGCT
CCGTGGATGTGCTGTTGCCGCTAAGCCACGTGTGCTGCAGTGCTTGCCCAGCGGTCAGTCGTTTGGACGGATCCGAATGTAATAGCTGCGTCAGGAAATC
CTTTGAGTCAGCAGAGAGGTCCTTGTACCATTGGTTCTCCACTGCTCTCCCAAACGTACAGCAAGTACAACGAGCCGTAAGTCTCTCGCCTTTATCGAAT
CAAAGCTATCAGCCTCACCATCATAATTTCCTTCTGCGATTTCCTTCACAATTTCTGCATCTGATCTGTCACCTCTTGGATCAAACGGGTGCACACCGGT
AAGTGTGATGTACGCCTGGCAAAGCAAAAAAAACGTGTAAATCATTGAATCGACTTCAACAACGTATATCGATCCGCCTACCAGTACACCAAATGCCCAC
ATGTCAACGCCAAAATCCTGAGGTTGACGCGTGATGATTTCAGGGGCCCAGTACGCACTGTACACACGTAAAGTGCACAGTATGAGCTATAGCACTACAA
TACCGGTAGCATGTCCGGTTTGATCGCGGGACAAGTACTTACATTGTGCCGTTTGGAAACTTCTCCACTACTTGCTCCCCCTGACGCTGGCGCCGACTCA
ACCCGAAATCCTGCATGTGCAAGTAGCAATAGATCATGGAATGCTAGCATTTTCAGGTGACAAAAAGTCGTCCTACCGCCACTTTGATGTTTGCATTGGT
AGATCGGTCGGACAGCAATACATTTTCGGGTTTTAGGTCTCGGTGGCTGGAGAACACAAGCATTTAGCAGTGAAAGTTTGACAGGCATAGATATCGGACA
CTTCTTCTAAAACGTACCAAACGCCACGAGAGTGCACGTAGTCTAGTGCTCGACAGACATCATGGAGAAAGTGGGCAGCATCTTTCTCCGATACTGATCC
CTATTGTCCAGAAGAACAGTAACGCGCAAGTTAGACCATTGCCAGCCCCGTACCACAGCAGCGCTGTTCCTACCATATCAACGATATAGTCAAATAGCTC
GCCGCCTTCGACCAAGTCTGTCAGCATAATAGTCTCATCCTTGAGATATAGCACATCGTGCAGCGACACGATGTTTTTATGTGTGCCAAGATGCCGCAGA
ATATCAATCTACAGTGCACAAACACCCTTCAGTCAGTTGTTGCTTCCCAGAAGCATCAAACGCTAGGCACCTCAGCCTGAATAGTCTCCATGGAAGAGCT
CTTCGGGTCGAAAATCTTGGCTGCAAGCATCTACATATACGAAAACCGAGCGAGCGCAAAGCGTCAGCAAGCCTGCTGCGAGATCAACTCATTCTTCAGC
CACCCTCCCCACCTGCTCGGTCTTCGTGTCAACTGCAAGACGAACAACTGAAAAGCCTTCACATCAACAAAATCAATAACAAAAAGAATAGACTCCTTAG
CTTCCTACACCTCTCACTCTCAAGAAGAACCCTTTGAACCTCCTCGTCCGAGCTCCTTCAGCAGCGCGTAGTGTCCTCGCTGCTCTGGCTTGGTGCTCGT
CCACCACGAGTCTCCGCTCGATCCGCACTCCACTTCGCTGCTGGGCGTCTCGTGAGACATCATCACAGCGACCCCCAGCGCCGCCGCCGTCGTCACGAGA
CCGACCCACGCCGTCCCATTGCCGTACGCAGCTTCTTTTGGCTTGGCAACCGGCAGATGCTCAGGGACAGAGGTCGGTGGCACCTTTGAGCGCACTGGGG
CGCGCGTGAGGCGCGTGATCAGGCGCATGCGCATGGCCACACGTCACTAACAGAGCTTCTCACAGATTATCGGGAGCTGGACTGAAGTCCTTGAAGCCTG
TAGTACAAGGTCCCTCTCAATAAGCAAAGGGGGTCATCAAATCGATTTTGGAGGGATTAGAGATGTGCAAGTGGATCTGTACTGACTTATTTTGAAGAAG
TGATCAAAAATATCGGGATATCGAAACAACGAGGTGCACTTATTGAGAGGGACCTCTGTACTGGAAGAACCAAGTTGAAGTCACTCATCAGTGATTGGCG
CCGCGAGGTGTGTACGGGTTCACCTCCTCCTCGAACAAGTCGGAGGCGAGCTTGGACAGCGCGTGCATGGCCTTGAGGTCGTCCAACGAGATTTTGTCTC
GAGCTCTGGAGTCCACCGTGCACAGGCAAGCGGCCACGGAGCCGTCGGGAGATTTGATGGGGAACCCCGCGAAGAACCGCACGCCGATGTCTCGCACGAG
TCGAAGATGACGCAGCTGTGGGTCTCGCATCGGGTCCTTCACCACGAACGGTTTTCCGTTGGCCACTAGTGAGAATGGGCACACTGTCACCTCCGTCCAC
GGACGCGGAGCTCCGGAAGACCCGACCACCCGCTGCGGTTGCGCGCTGTGGGAGCCGTTGAGCGCGACAATGTAAGCGACAGAGCACCGCATGCGTATGG
CAGCAACCTCGCAGATCGAGTCCAATGCTGCGGAGTCGAGATCGTCGTCAAGGTCCAGCTCCGTCTCCATGTTCGCAGTTGTGGCCCACGGACGCGGCAC
TACGGAGGGTCGAGTATTGACGTCGAGCCTCATCGAGGACGAAGAGCATTGTCCGCTTGTACTGCGTCGGCGGCGTTGCATCACTTCTTGACGATTGTAG
AGCGAGCTTGATTGCTCACGTGGGAAATTGCTGGTACTGTTGCTGTCTGTGATTGTTGATTCGCCACTGAGAGAGATGCTCGAGAGATGAAGCCTTGCCT
CCAGATACTTGTCCACCATTTTCCTGTCGGGATTCTGGGGGTGAAACACGGGAATCGACGAGGTGAACGTTGAAGTCGATGAAGCCGTGGAAGTAGAGCT
CGTCGGCGCCGAATCGGTTGTCACTTGCCTCACCACTTGACGCACTATCTCGAGCGCTTGCGCTCGGATCAATGGGTTGCCCGAAAACAGAGCATCGGCC
AGTTGTCGTCCAGGCGTCGAGGAGAACGACGCAGAGGCTGTAGCAGCGCTGCTACTCCGATCCAGTCGGTGCATCTGCGCTTCAAACATACTTTGGGTGT
TCGATACTTCTTCTTCATCTTCTGCGCCTGTGGATTGGGAACTGTGGTCGTGATCGTTTTTTAGTAAAACGTCGTAGAAGGCTGTCGATATCTTCACGCC
TGCTGCCTCTTCGGTGTCAACATCCTGTCGCTTTTCCTCGCTTGATCTGATCCCAGTCGTTGATGTTGACATCCTGTTAAGCGACGCGTTCAGAAGGGGG
TTATCTTGGTGGAAAACGCTGGCATCCACGTTGGCGACGCATGCGAAGCAAATGCGATTGCGGCGCACGCTGCGTGCCACAGGTTCTACATCAAATTTCC
GAGAGCACTCGCGGCAGACACGCTGCGCACAAAGTTGGCAGAACCGCTGGGGACGCAGCAACCCAAAGTTCTTTAGACACACCGAGCACCTGTTGCCTTG
CACTGCGTCGTGCGTCACGGGCGTGTGCAGGAATGGCTGGTACCCCAAACGGCGACGACGAACGAGCTGCTCGAACGATGTCGTCGCAGCAGCCAGGAGG
TTGACGACGTACTTGGCCTCCGCATTGGCACTCGGGGGTGCGTAGCGTCTTCCCGATGACTCACAGACGGCAGAAGCACTAGGCTGGTCCTTTGCCCAGA
ATCTTGTACGCGCACGCGGGGTATTGGTTGTCGGTGCTGGCGGGTTGGAAACGTATGCTGTCATGACGATGCGTGTCTGGTGTCCATTCAGGTCGCTGTA
TGATCCCGTGAGGTGGTAGCCAGCAGCGATGTGGTCCAAGTCGCCTCGAAGCGCTTGTTCCGTAGCGTGCTCATCCCTGCGGCGAGTGAACTTGTCGTGC
ATGGGTTTGGGCAGAGTTTTCATAGTGTAGAAGGCCTCGTTGGTCGCGGGGCAGTGCTGTGAGTATGCAGCGAAGCAGAGTCGCTGTCGGCGACTAGTGT
GCTTGGCCGCTGACACCGGGTTCAGGGACCGGCGAGAGCGCAGCACCACAGATTGCAGCGCAATCCATCCCGGTTGAGAGAGGTCATTCAAGTCCTCGTC
TTCCCAGCAAGAAGCATTGTCGTCCCCAAAGTCCATAGCTCGCAGACTTTTGCGAAACTCTCGCGAGACGAGCAAGTCGCCGCTTCTGTACTTCCTAGCG
CCGAAGAGCGCGCTCATGCTCGCATCGAACTGAAGCGGCTCGCGGCTGAAGAGCATCGTCAACGCCTCGTCCACTCGACAGCTTAGCGTGACGTGTGCCG
ACACCGCGTAGGTGACGTTGACGTCGTTCAGCGGCCATTGCAGCAACGCTCTCGCCTGCACTTCGGAGTGAGTATGCTCTCCCACGAAGGCGTCGCGAGT
GTAGAGTGAGCCGCGAGACTCAATCATTGAGTGGCGAACGTCGGCACTTCTCATCGTGCCGCGAAACCAGTGAGGGCCGTCCATGGTCTTCGCCAATGGG
AGTTTGGCTCGGTCGAACTCTCTGACCTCTGCACCGTGCTGCTTCTTCTTGACGACCCAACAAGGTGGTTGCTGTCTGTCAGACGTCGTTGACTGCCACA
AGCTGCCTCGGCGACTGACGTCCTTGCGGTTCTCCACGACAGCGCGGAGCTTGGGTACAACGCTCGCTGCTATCGTGAACAGCTCGCGGTCGGTCACGAG
AGCGTTGACCGAAGACGTAGACAGCAGTGCGTTGCGTGCCGACACGGGGGAGGCTGCGCTGCTCTGGAAGTCGCAGCTACGGACGCTGCCTCGGCAGCTG
CTCCCCTTGTAGCTCTCCGTCATTCGGACTGACGTGGGCGGATCTGCCAGTTGAGGCAGGAAGGAGTCGCGTGGAGGGTGTCGTGGGCTCAGCAAATTGA
GGAGTGGGGACAGCGAACCACCGGGCGCACTATTGACGCAGCAATTAGCAACATCGAGTGTCGACGGCACCGGATGCCTGGCGCTGCTGCTGGCTCTTGG
TGATGCCCTCGCAACGAGGCATCAGCAAGTCGCACCTTTTTCGACGGTCGGGGCGCATTTGTTCGGCACCAACGTTGCCGCGACCAATTTTTGTCGTTAG
TTGAAGTTGTACCGATCTTTGAAGGCTGCATGGTCGTCATGAAAGCTGCTGATGTTCTGTAGCCCTTGAAGGACTTCCAAGCGCGCTGGTAAAGCTCGGC
AAAGGGAATCTCGAGTGCTAGGTTCCTGTGCTTTGATGGCGCAGGTTTACCCAGCGCTTTCGGCTTCTGCTAGGCACTGTCGCCTCGTTGGTTACACCAC
GCGCGTCATCTGTAGCAATGGAGACACCCACCGTCCACCGAGGTCGTCATTCGAGCAGTTTTCCACTTCCAGTTGCCTTTACAGGCTGGCGTGTTGCCGA
GCACGCAAGCCCCGGAACTCCGAAACATTTCGCTGCTTGGAGCAGTCGCGAGATCGTGCTCGCAGCTGTGTTTGCTAGCTGAGCTCGTCGAAGCACCAGT
CATCAAGGGATCAGCCGGTTCACACAACCGATGACTGGCATTCCACACAACCCAAACAAACAGCACAAAGATTATTTGCAGTGATGGCACGATACCAAGC
AAAAAAAGCTGAAGGGAAAATCGCCTTACTTAAAAAAATAACGGAGACAACAGACTTTCCAAATGCATTCTGCGATTCGGGCGTATCCGTCTACAGCTCG
TCGTGCTCGTCGTCGTCGTCGTCGTAGTCCTCCTCGTCGTCCGGGGCAGCGCCGCCCTGGTACACCTTGGACATGATGGGGTTGACGAGCTTCTCGACCT
CCTTCTGCTTCTCCTCGAAGTCCTCCTTGTCAGCCTCCTGGTTGTCCTCCAGCCAGTCCATGGCGTCCTGCACGGCCGTCAGGACCGTGTCCTTGTCGTC
CTCGTCGATCTTGTCCTCGAGTTTCTCCTCGACGTTGTTCTTGAGGCTGTATAGGTAGCCCTCCAAAGCATTGCGGCCGTCGATGCGGTCCTTGACCTTC
TTGTCCTCGTCGGCGAACTCCGCGGCCTCCTGGACCATGCGGTCGATCTCCTCCTGCGACAGACGGCCCTTCTCGGCAGTGATCGTGATCGTCTCGGCCT
TGCCCGTGCCCTTGTCCTCAGCGGACACCTGCAGGATACCGTTGGCGTCAATCTCGAACGTCACCTCAATCTGGGGCACACCACGCGGGGCGGGCGGCAG
GCCAGTGAGCTCGAACTTGCCCAGAAGACGGTTGTCCTTGGTCATGGCACGCTCGCCCTCGAACACCTGGATAAGCACAGCGGGCTGGTTGTCCTGGTAG
GTCGAGAAGGTCTGCGACTTCTTGGTCGGGATCACAGTGTTGCGGTTAATGAGCTTGGTCATGACGCCACCCACAGTCTCAATACCCTGGGACAGAGGCA
CCACATCGATCAGAAGCACGTCCTTGGTCAGGTCGTCCTGCTCGCCACCCAGGATACCGCCCTGCACAGCAGCACCGTAGGCAACAGCCTCGTCGGGGTT
CACACCGCGCGAGGGCTCTTTGCCGTTGAAGTAGTCCTTGATCAGCTGCTGCACCTTGGGGATACGGGTCGAACCGCCCACCAGCACAATCTCGTCCACC
TCCGACTTCTTGAGGTCTGCGTCCTTCATGACCCTCTCGACGGGGCCGAGCGTCTTCTTGAACAGGTCCTCGTTAAGTTTCTCGAAACGGGCGCGGCTCA
GAGACTCGGTGAAGTCCTCGCCGTCCAGCAGCGACTCGATCTCAAGACGCGCCTGGGCCTGGGCCGACAGGGCGCGCTTGACACGCTCCGCCTCGCGACG
CAGCTTCTGCAGCGCACGCTTGTCCGAGGCCACGTCGAGGTTCTTGTCCTTCTTCCACTTCTTAATGAAGTACTGCATGATACGCTGGTCGAAGTCTTCG
CCGCCCAGGTGCGTGTCGCCGTTGGTGGCCAGCACCTCGAACACGCCACCGTCGATGGCCAGCAGCGTCACATCGAAGGTGCCACCACCCAGGTCAAACA
CCAGCACGTTCTTCTCGCCCTGTGCCTTCTTGTCAATGCCGTAGGCAATGGCAGCGGCCGTGGGCTCGTTGATGATGCGCTGCACCGTGAGTCCAGCGAT
GGTGCCGGCGTCCTTGGTAGCCTGACGCTGGGCGTCGTTGAAGTAGGCGGGCACCGTCACGACGGCGTCGAATACCTCGCGGCCGATGTATCCCTCCGAG
ATCTGCTTCATCTTGGTGAGCACCATGGCCGAGACCTCCTCGGGCGCGAACTCGCGCTTCTCGCCCTTGACCTCAACCTGGATGAAAGGCTTGCCGTCCT
TGTTGATGATCTCGTACGGCAGCAGCTTCTTGTCGGACTGCACCGACTTGTCGTTGTACTTGCGACCAATGAGGCGCTTGACGTCGAACAGCGTCTTCTC
CGGGTTGATGGTGGCCTGGTTCTTCGCGCCGTCGCCGATCAGGCGCTCGTCGTTCGAGTCCCACGCGACGTACGAGGGCGTGATACGGTTGCCCTGGTCG
TTGGCGATGATCTCCACCTTCTGGTCCTTGTAGATGCCCACGCACGAGTAGGTCGTGCCCAGGTCGATGCCGATCACGGGTCCGCGGGCCTCTTCGGCCG
ACACGGCGCCAACGAAGGCCGCCGCCGCCATGACGAGGATCTTGGACAGGTTCATCCCTTCTCTCTTCTCGTTGCAAGGCGAAAACGATAATGACCAGCT
TCGGGTGCAACGCGTGGAACTCAAAGATCGAAGACCACGTGGCCGGGCGCGGGTTTTCTAGAAAACGGGTTCGAGAAACCCGCGCAGAAGCCACTTGGTC
TTGGTATGCATCATACAAGAACCAAGTGACCGACTGCCACGCGTCGAGGAACCCACTAAGTACGAAGATATGCGACGACACACTTGCCGGCCACGAGAAT
GGGGTCAAGCCCCGACGAAGGCGGCACGAACGAGCGTGTGGGGCGTACTGCACAACGGCAGTGGCAGGGCATATGCGCTGCGCTGCTGACAATGGGTGGA
CTTGAAGGCGACGTTATAAGCCACGTGCCTCCAGAACGATGTTCGTACTTAGTCGAGGGCAACATCCACGTGGCAACCACCGACCGAGTTCCGCGTGGCG
ACATGATGCCAGCAGCAACGATTTGCAGTAAATAGGCAAACGACAGCAACGATCTGCCACTGCAGGAAACAAATAAACTGAGGTGGCATGGACAAGAGCA
AACGACTTGCTGGTAAAGCGCTAGTCGAGCTGTAGAGAGTAGACAATGAAATCATGTTGAGGGCGTTCTGGCGCAATCGAGTTACGAACAGCAACACTGC
ACGGGGAAAGGGAGACCAACGATGCACGGGATGGCACCGACGTGCCAAGTGGGTGTAGCGTGCAATGCCATGCTTCTCGTAGAGGAAGGAAGACTCGTGC
ATGACCGCAGTTGCTTGTCTAATGAAAGACTAAAAGTGGCTACACCTAGGGAAGCGCTTCTTGAGACGCACACTTCCACACACGTGGCAGAAAGCGGTTG
CACTTGAATCACCCTTCAACACCTGGAGAATACGATTGTGGCTGTC