Description :
From Genome Similarity Track
Location :
Scaffold_66:75511- 77802
Sequence
2291 bases(100 bases per row)
CTGCGAGCTTGTGACATACTGCTGTAATGCGCCAGCACCTCAACGCGATGCTCAATCAGACATGCGGTAACCCTGTACAGTGAATGCCAGCGCGTGAAGC
TCATGTTCGATCACCTTGATCGCGTATCGTCAACGAGCCGTTGCTGACGCCGTAAATGGATAATAATTGCGAGAAGTGTCGTCATAGAGGTACCTCCATC
CAGAGCCATCCATGCCTCCTCCAGCGTAATATCCAGATGGCGCTACAGGCACCTGATGCAAATAAATCCAGGTATCGTCGACGCTTGCTGCAGCCTGGTC
ACGACACCTTGGATAGCTTCAGTCATGTTGATTGCACCGTCACAAGATACTCCAATCAGCGTCTCGTTCCAGCACGGGCATAGGGATTCCAGCAGCTTGA
AGATCAGGTTGAATTGGGCCAGGCAAATATGAGAGCCGATCATGGGCAGGGCAGCGACATAGTAGTTGCACATTTAACCTTGCCACGCCAGGCCAATGCG
GACGTCGAGGTACGACGTGTCCAGGCGCGGTGCTGCCATCCAGCTCTAGGCCAAATGCCCGCTGTAGGAGAATACACTGGCAAGAATCGGGAAATTGAGA
TCGCACTGCAGACGCGACAAGGTGGTCACTTGAGTCGTTCACGCCGCCAACTTTTGCACAGATTGTCTTTTCCTTGGCTGCCTGAACAGCTAGCGCATTC
TTATTGAGGCTCATGCAAATAGCGATGAACTTAACACTCAGACGGAAGAGCACTGATCTTGAAACTGTCACAACATAAACACCATTGTCATTGTTCCAGT
TGACGATTCTCGTTGTAGTTTCGTAACTAACGCCTTCAATGCCATCCAGATTCAACAGCATATCGACAATGATAACGTTGACAATATTGGCCTCCAGCTC
ATACTTAGTAGTAGCCAAAATGGGGTCCAAGTAGGCCACAATCTGATTAGATTATAGGACTGCAACATTGAAGTGGGCCTCTTTTTGACAAGCTTTAAGG
TTCTGGTACACTACCCACTATTTCTGGTGCTCACGCTGCAGATGGATCCAGTAATTCTTAGGCCTGAATTACGGATGGAATGTCTTGTCAATTTCCGTTT
TCTGACGCTTCTGGCCTGGAACCTCCTCACGAGAACGTGATGCAAAATCTGTACGATATGGATGTGACAGAATACGACTCAGGGTCGACCATTTCAACTC
GCAGTTCATTTTACGCAGCGTACTTCGTTTGAAATGGTGTCGAGGGTGATTAGTTGACTTCCCGCGCTTCTTTCCCTCCATATTAAACACTCCATAGACA
CGAGACTCTGTTCAATTCGGTTTATTTGTCGACGAGCTTGGAGAGGCGCAAGCTGAAAGAATGGGGTGTACAAAGTGCAAAGAATGTCTGTGGTAAAGAA
GTGACCTTTTAAAGTTTGTGGAGTAGATGGGGAGAGATGGGGAAGGGGGGGTTTCTGGAGCCACTAAAAATAAATAGTTAGAGGGGGTGTAGGCGAGTTG
TGTTTTACGGTTGAAATCCACTGAACCCCTTAGCCTTTAAGTTCCTTTCCCCCTCGTTTGTTTGCTTTTGCCTAAAGGATTGAAAAATGAACGATTACCC
GTATGGCTGCCACCACTCAGATCACCATGGATTCTTGTATTCACTAGTTTAGTACACTCAGACACTTATTTTCCTTTCAACGGTTCATTGGTATGCGGGA
ATATAATTTACTTTGCTCAAGAGTATTCTCGTATGATTTTTGTCTCTCGGAAAGCTCAAAAATTTCTGATGGTATGTGTTATGAGTTAGCGGCCATAAAA
TGAGCATAATATACCGCAATTTTTATAAGTTATAAAAGTTATGAGCAGCCCTCTGTAGATCAGGCATTTTGTGAAACAATGCCTAACTTGCCTAATCTAA
AGCCCAGCAAGTGCCTAATCGGAAAGTATCAAATCTCCGTGGCGTGCATCGTTATAAACTTCTGAAGTGCCATCCGCATCTGCCGATTGGCATTAGAGAT
CTATGCCTAAATAAAAAGGAAAGTAAAGTCTTGTTAACCTGAAAATTCCAAATTAATTTTTTTTCCTAGGAATTAAATCAACTCTAACCTTGTATTTCTT
GATAACACCAACCACTTTCTGTGCAACTGTCTTCTCTAAATCATGTTGTACATAGGCCTAAATCACTTTCGTCATTGTACAACATCAGCCTAAATTTAGA
TTTCCTGAATCTCACACGCCAGTTTCGTTCATGTTACAATTATTTGGGCTTATAGCAAGCAATTATAGCCCGAAGTCCAGGCAATGCTGCA