Description :
From Genome Similarity Track
Location :
Scaffold_53:75504- 77705
Sequence
2201 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCCTCACCCGCATCTGGCTCCGCCGACTCCTGCTCCGTATAATTCCCACGCCGAGTCCTACGTATGGCCGCCTCGTCGTCAGCTGCCATTCTGTGGA
TTTCAACAGACTCGCCACGCAACGCGTCCGTGAGTCCCTGGAGGGTTTCCAATCGATACTGGAGCTGGTTCTTCTTGATGAAGCGCAGGCGCTCTTGTTC
GCATTTGGCCCATTGGTCAACGCAGTATTGCTGCGTCAGTCGCCCACCGCGCAGAATAAGCGAATTACTAACCGTCCGGTCGTAAAGCAGATACGCCTCA
TATTCCCGAACGGACATGGTTAAGGGGTCACCGTGGCGATCGACGGGATTACCAACGTAGGGGATATCGTAAGTCCAGCCATTATCCCCGTACGGAAACA
GTAGAGGGTACTGCAGCGGGTCGTAGGTAACGCTCGTCTCAAAGATGCGCTTGAAACCTCCTCCTGTCGTGTGTAGGATTATATCCCGATGTTCAGCCGC
GTTTGTATCGATCACAACGGCTGCCACCTCCGATGCCGTTGGGGTGTTATGCGTACCCGGATTCGCATTCCGTGTCACGTGCAGACGCAGCTTAAGGTGA
TCCCCCTCCGGAAGAAAATTACTCAAGGCTAACGACGGGTCATGGTCATCAACGTATTCCCCTGCCGAGCGGCGTCGTTCGTGCTCCCTGATGGCTGCTG
CATACGCATCCCAACCACGATCTATCAAAAATCTACGCGCGTTGATAAATTCTTGTGTATACGGGGTTGTGCGCCACCATCATCTGGTCAATTGTTTCCA
TGACGGCACGATCGAGGCCTTGCGTCATGTTCATACGGCTTCGCACACGTGCATCCATGTCTGGATCGTTAAAGTAAACTTGGGCATACATGGAGCGACC
GAAGGTAGGCAGGTAGTAACGATCCCATGCGATGACACACTGACCCTTGTACACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCGCGGTCGGAAGATGGGAGGAAACTCTATTGGAAAGGCCGGG
TGTAGCCATGCGAAAAGGCAGGAAAACGCAGCAAGAAAGGAACCGGACGGACTTATTGACAGACGGACGGACAGACACGCTGCAAGGTTAGGGGGCGGGA
A