Description :
From Genome Similarity Track
Location :
scaffold_96:7547- 10006
Transcript NameFunction/comments
Plaha_PHALS_02240hypothetical protein

Sequence
2459 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGACGATCTGAAGGGgccgacggcgtgctttgagtttggcaa
actcaaaccgaacGTGGAGCTCCACATGcacatccacttccttgtgaatCAACggtaaggcatacagtgatgAAAGCTTTCGgggccgttgcacccatcg
ctcaaagagcgctccgtcatctgtagcgcttttgccaggggcgagcactacaggtatcgtccgcattgcgggtacacgagagccacctcgttgtgcacgt
agacgagtgcgataaacgtccaacggaaattcttgtgggaacaagaaacgagctcgaagagctttccgttcggcaaacCCAGCTTCCGTGATGGCCGGTA
GCCCAATGATggggacgcgtaacgatcgaataaccgcgtccttcgcttccacagcgggatccgccgggcgggagccatattccacacaagcGTCAATGcc
tgaccgtggatgggcgcgcatcagagccgccttacgggtaGCTTCTAGCTTCTAGCTGTCGCctttgtgcctcgtcgaggttattggtgatgacaccatg
TTTCTCAGGTGATGAaaggtcaggaaacggacatggggttcgcaaggcgcgagcagggctcgtctcacgccgctggcgcggctcgccttcctcgtcgatc
cacccgggaaaaggagtgtcagactcgtagtcgaccacctccacatcccaacgaggtcactcgtcactgatagtgTGCatggagcgcgacgctcgggctc
atcgagcctagaatttacatccctcgatgccgcggacacacggtccgacatggcaccgcgtgcgaagacgaagttgggctctgcccgtgagcgctgtcag
aaccagcaagATTCGGAGATTTtggcgtcattgacacagcgTTCAttaagcacggaagtcgtttcgataagttgcagtgtctaacggacacgcaagcctc
gttgaggcaataatcgattggaactttaaatgttctcaatcttcatgggaagagtgtaacggggttacacatacccttgtaACAggagtgtgtgtcacac
cagatgggcatagtgtgaccacacacaaacaagaatacggcacAGGGCtgaatagccagtagttatacatatatttagattttactatacatatttagga
aattctttgcatttaaaattaggcggctttgccgcagatgacactaaaaaaacattttttgacTTTatacggaagagttaatttccgtgggttaaggttg
taattattcttggagtaagcggattgcgattcgctaaacTCGTTCTTGttccaagtatagaacgaaagatcggtgacctaacttacgcttcctctaagct
caaagctacggcagccccgctgcaatggcTGTCAAATAATTACGAGTCAAGCAGATAGAGCTCAAAATTTGTTGTGAGAAGCATCTTGTGAACTCGAATG
CTCTTTTTGCAGCTATAATTTGGCGGAATTAATGGCGACAATAGCATAGTTACGCCGTCGGTACTAGCTTAAAGTTCATCCCAGATTACGGCAATAACGA
GGTGTTACTAATGACACAAAGTTCCCGATCCGAATTATACTAGACCGTCATTGTTTGATTTGCACAGAAGAATGTTCTTTTCGGCATATGAATCCGTCTC
TTTGCTGCACTCAAACGCCATCTGACCAGGTGTGCCGTGTCGGGCCATTTTGCATATTATACTTCCATCAAGAGAGCAATAATTTGCAAATTGAAATGGT
CTTCATCTGCGCGAATCTGCCCGCACACTAACGTTATGAACGGGATATCCCTTGGATATATTTTTGTTGGCGCCAAAGAGAAACTAGTGAATGCTGATAG
TCAACATAATTTAACGCATACACCCAAGCACTATTCGCAAGTGTTAAGGGTAGATGTTA