Description :
From Genome Similarity Track
Location :
contig_13:754675- 756037
Transcript NameFunction/comments
g2956.t1ETK76274.1 hypothetical protein L915_17289 [Phytophthora parasitica

Sequence
1362 bases(100 bases per row)
GGCCGCCGGGTCTTCGATCAGAGCAGTGAACTCGTTGATTTGCGGTAGTGAGTCTTGCTGCACCATCGCCATGTTAGATGGAGACAGTCGGCCTTGGTGG
AACGAGAACGCCTCGGTGTTTCTGGCTTCGACTGCAACTTTGCGTACGGCACCTGACGCCAAGACCCATCGTCAGAGCTCTCCGGGATGTGCGAGAGGCT
TGCTCCTCCCGTGATGAAGTAGTATTGGCTACGGATCAGCACCGTGAGCTCTTCCTCAATCTGCAGCAGCCGCGACTCTAAGTCGATGTCGTTCGCATCC
AAGCCAAACGGACATTCAATCTCCATCGCGACTTCATCGGCCATGAAGAGGAAGGTCCCCCACAAAAACACCCAAATCGGCGTGTAAAGACCCGAGTTCG
GCACAATGACGAAGGTGTAGAGCAGCATGTAGGCAGAAAGCAGGTACTGCAGGTACTGCATGTAGTTGAACGGGATCGGGACGTTGGCGATGTTGAACAC
CGTCGTGTACAGGTTCGGGAGTTGGGCGATCTTGATCTGCAAGTTATTCGCGTTGGGCAGCGTCAGATGGCCACGCCGAGTGGCAACCTGCACAAGTCGC
TTCAGCCAGAGCTCTGTGATCGTAGCACGCAGCTTGTGAGGGGTACGGCGCACCAGAGCACGGTATGACTCCTTGTCCTTGACCACCTTCTTGTGCTCCG
AGCCGCACGCATACAGCTCGTCGTACTCTGCCTCGGTCAGTACGCCCGAGTCCTTCAGCTTGTCGATACCGTCACGGCCACGGCAGTCGTGAAACACGAT
GGCAATGTACAGGAACACTAGACGACGTAGCTCTGTGAAGAACGTGCACTTCTCCAGCACATCGCGCGGAATCGACTGCTGCTTGTGTCGAGCACCTCCA
AGCTGCTTTCGCTTCTTGTCCAGTTCGATCTCTTCATCCAGAGTCCTTCCTGCTCGCTTTGCTGCCTCTGCAATAGCCTCGTCGTTCGTGTCCTCCACGC
CACGTTCCTTCAGCTCCTCCTTAATGGTGGTGCTCACGTATGCACAACCAGAGCCGACAATCTCCCGAGCCACTTCGGACAGCGACCCCACAGCCACCAT
CCCCGCTCTCCATTGTGTGAAAGCCGAATTCAATCGGAACGAGACGATGAGCCCCAGGAACGTGTTGAACACCGTCAACGAGTCTGTGAACGCCGTCGAG
TTGCGGGTGGCCACCACGAACGGGTGGTAGTGGTTGGCGACTGCAACGACCATGGCGACGGACGCCATGATCAGCGCTCGCACGGGGGCTTAGCCATTCA
AGGCGGAGCCGTGCCATCGCAGCAGCACCCCCCAGAGCCGCGACGTATTGTAGTAAATCATC