Description :
From Genome Similarity Track
Location :
contig_13:754633- 755995
Transcript NameFunction/comments
g3116.t1XP_008896258.1 hypothetical protein PPTG_04164 [Phytophthora parasitica INRA-310

Sequence
1362 bases(100 bases per row)
GGCCGCCGGGTCTTCGATCAGAGCAGTGAACTCGTTGATTTGCGGTAGTGAGTCTTGCTGCACCATCGCCATGTTAGATGGAGACAGTCGGCCTTGGTGG
AACGAGAACGCCTCGGTGTTTCTGGCTTCGACTGCAACTTTGCGTACGGCACCTGACGCCAAGACCCATCGTCAGAGCTCTCCGGGATGTGCGAGAGGCT
TGCTCCTCCCGTGATGAAGTAGTATTGGCTACGGATCAGCACCGTGAGCTCTTCCTCAATCTGCAGCAGCCGCGACTCTAAGTCGATGTCGTTCGCATCC
AAGCCAAACGGACATTCAATCTCCATCGCGACTTCATCGGCCATGAAGAGGAAGGTCCCCCACAAAAACACCCAAATCGGCGTGTAAAGACCCGAGTTCG
GCACAATGACGAAGGTGTAGAGCAGCATGTAGGCAGAAAGCAGGTACTGCAGGTACTGCATGTAGTTGAACGGGATCGGGACGTTGGCGATGTTGAACAC
CGTCGTGTACAGGTTCGGGAGTTGGGCGATCTTGATCTGCAAGTTATTCGCGTTGGGCAGCGTCAGATGGCCACGCCGAGTGGCAACCTGCACAAGTCGC
TTCAGCCAGAGCTCTGTGATCGTAGCACGCAGCTTGTGAGGGGTACGGCGCACCAGAGCACGGTATGACTCCTTGTCCTTGACCACCTTCTTGTGCTCCG
AGCCGCACGCATACAGCTCGTCGTACTCTGCCTCGGTCAGTACGCCCGAGTCCTTCAGCTTGTCGATACCGTCACGGCCACGGCAGTCGTGAAACACGAT
GGCAATGTACAGGAACACTAGACGACGTAGCTCTGTGAAGAACGTGCACTTCTCCAGCACATCGCGCGGAATCGACTGCTGCTTGTGTCGAGCACCTCCA
AGCTGCTTTCGCTTCTTGTCCAGTTCGATCTCTTCATCCAGAGTCCTTCCTGCTCGCTTTGCTGCCTCTGCAATAGCCTCGTCGTTCGTGTCCTCCACGC
CACGTTCCTTCAGCTCCTCCTTAATGGTGGTGCTCACGTATGCACAACCAGAGCCGACAATCTCCCGAGCCACTTCGGACAGCGACCCCACAGCCACCAT
CCCCGCTCTCCATTGTGTGAAAGCCGAATTCAATCGGAACGAGACGATGAGCCCCAGGAACGTGTTGAACACCGTCAACGAGTCTGTGAACGCCGTCGAG
TTGCGGGTGGCCACCACGAACGGGTGGTAGTGGTTGGCGACTGCAACGACCATGGCGACGGACGCCATGATCAGCGCTCGCACGGGGGCTTGGCCATTCA
AGGCGGAGCCGTGCCATCGCAGCAGCACCCCCCAGAGCCGCGACGTATTGTAGTAAATCATC