Description :
From Genome Similarity Track
Location :
Scaffold_573:7546- 8926
Sequence
1380 bases(100 bases per row)
CGCAACAACTAACGGGAATTCATATATTATTTACACTCCTTTTTCCTACATTCATACATTTTGACAAACCTGATAATTTACGTCCGTATTGTTATTACAC
CTCATTACTCATTCTCGCTCCTTTACGTAAAAAATATTTACTAGGTGCTATATTTCTATCTTTCACTTTGTTTTGCACCATTTTTTTTATCAAGTTTGTA
TTCCGCTACAAGGAAGCGCACCGAACGGGGAGATGTGAGATGGATATAGTAATTGAGGATATCATGTATGGGAAAGAATTATCCTGAAATATATGATTGC
CCGTTTATGTGATATCGTAGGGGGTGGTCGTGAGGAGGTAAAACATTGTCATTATCGACGTTATCTCCAGGCAGTCTATTGTAAAGAAGTACGTACTGAT
ACATAATACTACTTTGATCTAACGTTTGTATAACATAAATATAAGTCTCAAATCATATACCAAACTTTATATGGCTACCCCCAAGGTCCAGTAACGTCCC
TTTGTTCCTCCTCCGCACCGTCTAAGGGAATTGGAAGCCGCTTCTGTAGTCTAGATAGAGTCCTTCGTGGAAAGCTGTCAAAATTCAAATTTCGGATGTT
CGATGAGGCTGCACATTATTCTTTTTGCACTCGTTACGCATAACGACGTCATTGTGGTGAGCTTAAGCAACCCATGCAGCAGGTAACGCCGAACAAACGA
ACGACCGAGATCTCTTTTGACCACGCATGAAATGATTTGTGACAGGTGCAGGTGCGCAATAATACTCCGACCATCTCATAGCGCAGTTTGCGGTGCAATT
CGTGGGAGAAAGGGTACAATATCGAGAACGCAGGCAGGTTTGTAAGATAAGAGCGTGTGAACTGCTGGTTTTTCGATATGTTGCAGCCTTCATTGTGAAT
CTCGAAATGGCCTGTCTACGAAGAAGCAGCACGTATTCTATGAAACGAAACCATAATGAAGGTTATTTTTGTATTAACGCCTTTACACTTTAAAAATCCA
GAATTTAGCCCATTCAGTTTCGACGAAATTGCTATGTGTCAATTAAGTAAATGACTTACAATAGGTTATGTCTATCATGTACCAAATTAGTAATAAAACG
ACGATATTTCATACTCTTATAAATATAGAAATAGCGATAAGGATAGGAAAATTGGATTGGAGAGGTAGAGGGTGAAGGGGGTTAAATATAAGGTTAATTG
CAATAGGTGACAGGATTTAAGAGTTTTACCAGAACGTGACAGGATACGTTTAAAATATGGATGTACTTTAGAGTGCGTTTGGACGCACAATATTCGAANN
NNNNNNNNAGATACAATTTAGTTGATCAAACAGCGTTAGATTACGTCAGGGAACAGTAAGTACAGGGTACCACTCTTGGC