Description :
From Genome Similarity Track
Location :
Scaffold_100:75450- 76939
Transcript NameFunction/comments
Phyra_72176glucose inhibited division protein A

Sequence
1489 bases(100 bases per row)
CGATGTGATCGTGGTTGGTGGCGGCCACGCAGGCTGCGAAGCTGCCGCTGCCGCCTCCAGAACTGGTACGAGCATTAAAACGCAATTGTGTCGGCATCTA
CTAACTGCAGGACTTTTTCGCAATTGCAGGCGCTAAAACTGCGTTGGTGACGCAGAAATTGGCAACAATTGGTGAAATGTCTTGCAACGTACGCGACGCA
ATTGCCCTTGATGGTTGTCGAATGACCCAATGAGTAATTTTTGTGTGTGTTGATTCTTTGCAGCCGTCCATTGGCGGTGTGGGCAAAGGCACATTGGTGC
GTGAAGTGGACGCCCTAGGCGGCCTCATGGGCCAAGTGGCCGACTCTGCTGGCATCCAGTTCCGGATGCTCAATTCGGCGAAAGGACCGGCGGTGAGAGG
CCCACGGGCTCAAATGGACAGGGATTTGTACCAGCAGGGCATGCAGAAAGCCCTTGAAACGCTGCCGAACCTCTGGCTGGTGGAGGACGGAGTGGAAGAC
CTCATGCTGGAGAAGGTTGGTCAGAGTGAAGAGCGGGTGAAGGGAGTGGTGACGTCCTCTGGTCGAGAAATTCAGGCGTCGCAAGTAGTAATCACTACTG
GTACATTTCTCCGCGGAATGATATACCAGGGGCCCGACATTCGCATCCCGGCTGGACGCCACATGCGGGACACGGACGGACTTGAGCCACCGGCGGTGGG
TCTCGCCCAGACGCTGGAACGCTGCGAGTTCCCTCTAGGTCGGCTGAAAACAGGAACTCCTCCTCGACTTGACGCACGCACAATCGACTACACGGGACTT
GAGATTCAGCCCAGCGACGATGTGCCCAAGCCGTTCTCGTTTCTGAACGAGCGTAAGGCTGTGCCGCTAGCAGACAAGCAGGTGGTCTGCCACGCAACGT
ACACCAACGAAGAAAGTCATCGAATTGTGCGCGACAATTTGCACATGCTGCCGCAGTACGATGGTGGGAGGGATGGCGAAGGTGTCGGCCCCCGCTACTG
CCCATCGATTGATGCCAAGGTCGTTCGTTTTGCTGACCGCTCGAGACATCAGCTTTGGCTCGAACCCGAGGGCTTGAACACGCACATCGTGTACCCGAAT
GGTATCAGCACGGCGCTGCCCGAAAAGCTGCAGCTCGAGCTGCTGCGCACCATTAAGGGACTCGAAAAAGTGGAGCTCGTGCGCGCTGGATACTCGGTCG
AGTACGACTATGTGGATCCGCGATCGCTGCACCCTACGCTCGAGACGAAGAAGTTGCCGGGACTGTATTTGGCAGGTCAAATTAACGGCACCACAGGGTA
CGAAGAAGCCGCAGCGCAGGGTATCGTGGCCGGCATGAATGCCGGTCTGAGTGCCATGGGACGAGAGCCGCTCGTGCTTGACCGTGCTGATGCTTTCACA
GGCGTGCTTATCGACGACCTGATCTCGTTGGGAACGACAGAGCCGTACCGCATGTTCACGTCTCGATCGGAGTTCCGTCTGCTGCTTCG