Description :
From Genome Similarity Track
Location :
Scaffold_1:75448- 77419
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_00038Hypothetical protein
Sappa_CBS223.65SPRG_00039PREDICTED: vignain-like

Sequence
1971 bases(100 bases per row)
AAGACTTGCACGGCTGTAATGCGTCGTACGTGTTTTTTATCATGCCAGTGGTCGAGAAACTAAAAAAACGCATGGACGTGATCGCGCCAGAGGGAGTTTT
ACCTATAAACGCCCGCTCCAGCACGTCGTCGCAGCGCAAGCTGATTCCATACAACGTTCTAGTGCAAAACGTCGTTGTGTGTCGAGACAAGTGGTTGACC
AAAATGACCAGAAGCACTGCGTAGCCTTCATTCAATTCATGTACCCCTTGGCCTAATGCGAACTTTTCGATGCACTTGCACACGAGGGATTCGTATCCGT
ACAATATTTCAAATCGTTGAGCCCCGGCGCCGCGCTTTGGACTCGAGGAAACACAGGAATACGCGTACGGTCTGATCGTTCATGCCCGACTCAGCGATTT
AGCGCGCGGATCGTGACAGCGAGGCGGAATGACGGTAGACCATCACTCAGAAGCCATCTCGGTCACACAACGTCGCAGGCTCATTTGCATTTGGACACGA
TGCTCCACTTGTACGCAGCGACCAAGAGCGAGCCGCAAAACGCTGTGTGGTCCAAGGCTCGGAGAGCTATCGCTCGTGCTGCGACGCAAACACCACCGCC
TCTGCGATGCACCTCTGTCACCTCAACGCTTGTGCGCCACGAACGAACGCTTCTTAGTCCCATTCTCGAAGAGCCGTGAGATTCGAGCGGTATATTTATG
GGAAATATACAGCAACTTGACGTTCGTGTCTTGGGTGTCTGTCATCGTCGTCTTCTAACCATAGAGCCAATACGCACCACTTCTCGCATGTAATGCAGCG
TAGTGAGGACCGAGGTCGGAACTCGGAGAGCCCATTGACATGTGACAGAGGACGCATACGGTTGTTCAAATCTGTGGCCCACTATTTACTTGCACCGATG
CGTGGCGTCGCGCGTCGTCTCGTGTCTGCCGCGTTCGTCGCAGGAGCTTTCCACGTCTCTTCGCCAGGCCGCCACACAGAAACGTGTTGACGAGGAAGAG
CAGCGAGGGTCTGTACCCAGGCCACCGAAAGGAGACCACCGCCCCTCGCGTGTTTGGCGACTTTGCCGTTTCCACATGGATCGCCGTGAGCTCCAAGATC
ATACAACCCGCGACACCCAAAACTTGTTATATTGGTACTTGTGTACATGGTACGCACGCTGCCACTTCTGGTGTCTCTTCCTAGAATTGCATCTGATATC
CAATCTGGTCACCTCTCGACACCTCTCGACACCGCGCGGCTACACCGGCGTCACTTTACAATTCGCCATGGCCGCGTTCGCTCTTGGTGCACTTGCTCTC
GCTGCCGCCGTGTCTGCCGCACCCATCGACGACCGCGATGCGCTTCGAAAGGAGCTGTCCGCGTGGAAGGCCAGCGACGCCGGTGTCTACGCAGCTGCCA
ACGGTCTTCTTCGCGAGCACCTTGACGGGGCGAGCGAGGACGCGGAGCTCGCCGTCTTTGCGGCGAGCAAGGCCGCGGCGGCTGCGCTCCAGAAGGCGCA
CCCGCTCGCCGAGTTCTCCGTCGACACGCCGTTTGCTTTGATGACGAGCGACGAGTTTGCGTCGTGGGTCACAGCAGCACGCCCGGCGCGCAACGCATCA
GCGTTGCCCGCGTCGTCGGAGGGCATCTCGGTTGCGACGAACACGGTCGACTGGAAGAAATCGGGCTGCGTCGCGCCGGTCAAGGACCAAGGCGGCTGCG
GCTCGTGCTACGCCTTCTTGTCCGTCGGCGCAACGGAGAGCGCGTACTGCCTCGCCCACCACCAACGGCGCACGCTCTTCTCCGAGCAGCAGACAGTGAG
CTGCGGCCCAGGCTTGGGTTGCCGAGGCGGGTACCTCGACGACTCGCTCAAGTGGATCGCTTCCAACGGCCTCTGCACGAGCGATTCGTACCCATACACA
AACGGGCAGAGCGCGACGGCGCATCCGTGCCAGTCGACGTGCCAGAAGCTCCCGATGCCGTTCTCCAACAT