Description :
From Genome Similarity Track
Location :
Scaffold_51:75433- 76932
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G013499Similar to MCTP2: Multiple C2 and transmembrane domain-containing protein 2 (Homo sapiens)

Sequence
1499 bases(100 bases per row)
TGGTCTCGTGAACAGTGTCGTCGAAGATCAACCGACAGTAGGTATCCCCTTCGAAAATGTTCTTCGCATGGAAGTTCTTGTCTGGCTGGCATTGCTTCGT
ACACAAATGGAGTCCTTGGAAATTCACGAAAAGCTCGCCGACCAGTCGTGACACATTGTTGTTCAGCACCTTGAAGATACTACCGTTTCGTTCAATCTGA
ACCGGACTGTCGTCACGTTTTTTCTTCGTAGCCTTGGCAAGTTGCTCCTTCTCCCTCGATAACGCCGAATCATTGGTATCTTCCAGACGCTTGCATTCAC
ATTTGGTCATGGCTTTCATAATACACGCTTTATGGACATCGATTCCACAGTATTCGCAGCGGTATCCCCAAGCGCCCTTGATCACGTTCATAATTACGCG
GTCACCTAGCGTAGTTGAAAAGAACGCCGCAAGTTAGTAAAGCATGCCAAATAACACCTCTCCGCGATCAGAACAACTTACAAACAGCGCAGTTCGGAAT
CGCTAGACCAATCGATTTCAGCTGGTGCACCCGAAATTTATGCTCGTTGTCGCTCGTATTGCTGCCTTCAAACGGTACGAACTTGATTGAGAGCAGGACT
TTCGGCTGACCTGTGCTTTGATTCATCATCGCGATCGGTGCCTGCACTCTCGACGAAAGTGTAAACCAACGCTTCGCTTCAACATGTGGGTATCGAAGCA
GTGGCGTCATATCCAACAACGTGCATGCAACGAGATCATCGGAGATATAATTGGAGTTCCATATCTCGACTTCCAGAAGGGGGATCGGTGTGATCGTGCT
GTTGTACATGTGCGAGAACTGCATCACGTTGTCGTGCATACTTTTCCAAAGCGGATTTCGACCTCCATTTTCAGCTGGTTTAGTCTGGAATGGTTCTTTC
CACGGTAGCAGTGAAAGCTTCGCATAAGGTGCTTGCGTACCCAGCAATTGTACGCCAGGGAGATCCATAGCACGATGAACAGTAACATGGAACGCTCCTG
GACGGTTCACGTCAGACAGGTTCGGTGCCTCGATGATCTGTTCACGCGTTTGGATATCCGGGTAGTGCGCGAGCACGTCGGCGGCAAACTGGGCGCATCC
GTGATGCGTGATGATGCCCGATTTCGTCAAGCGATGCATTCTGCCTGTGGCATCATCAGGCCATGACACGTCGCACATGTCGCATTTGGGTGGCGTATCC
TTTGGCAGCTCTTCCACCTCACGGTTATCAAACACTGGGTCAATCTCCGGAAACCTACAGCGAATGAAGCAAAAACGTAGACAAAAACATAAATGAGCGC
ATGTTCATTGCACTGCCAAGTATTCCAAAAGCTCTGTACCTTTCCAAGAGATCGGCTTCATCCCCTCCCTGCGGACTTTGACGATCTTCAAATGTTTTCT
GGATCATCTTTATCGTCGGATTCGAATTGCCGATTTTACGCAACTTAAACCTACACGACAAGCACAGAAGGTTAGCTACTGATACATACCACTTTACTA