Description :
From Genome Similarity Track
Location :
scaffold_74:75432- 77442
Transcript NameFunction/comments
g2829.t1 phosphatidylinositol 3 and 4-kinase-like protein
g2830.t1 conserved hypothetical protein

Sequence
2010 bases(100 bases per row)
TCGGATGACCGTGCGCGTGAGTCCTTTGAGCAGACGATTCATTTCTGCCTCGACAGTCGGTTCAAGCGCTTTGATAACTACTTGCACAACATTGCCCACG
CCTTCGGATAAGGGGAAAGCGTGCCAATCCAAGCGCAGGGAGTGCTGGGAGGTGCAAATCGAAGAAATAAGTAATCGCAGCCATGGAGTAGTCCGCCGAT
GTTTGCAGTCGCGCTGCAGGTGAGGAATAAAGCATCAGTACCATTCGAAGACAGCGAAGACCGCAGAAGTTCGTAGTTGTTGGTTTGGTAAGTTCGTGGC
AAAAGTGTATTGTTAATATCCAATCGCTTGATTTATGGTGCTTTGCTGCAAAGACTTTTCAACTCGGAAGCTGATGCTAATCATCATCATCTCTTGTTTA
GTTAAGTTTCTTCAATTTTTCAAAGTACTTCAAGTATGATAGTCTTAAAGACAAAAGAAAAGAAGAAAGACAACAGTTATGCCATTGACGAGATACGATG
AGTTCTGAGAAATGTAAATATATTGGCGATTAGCGAGGTGATATCGAATCAAGCAGAGTGTCTTGCTCAGATAATCTTATCCATGTCCCCTCCTCGCTGC
TCGCTTCTTGCACTCAATGAAGCACGGATTTCAAGTTTGCTTGTCTCTTTCTACGTCGAAAAAGTCACTTAATCTTGAGCTTACAGCTCCTCCACCAGAG
CGTTGAGGACGACCTGCACATTGCCGTTGCACTGCTCCAGACGGTCAATGACGACGGCAGTCTCAACTCCCGGGAAGATGTCGCGCACCATCGACAGCTC
GGCCGACCACTTGAGCTCCTCCTCCGTAACGACAGGGGTCTCCACAACAACCGGCGTCTCCACCACGACCGGAGTCTCCTCAACAACAGGAGCCTGCTCA
GTTACCTGCTCCCACTCACTGTCGCTCTGGGTAGCAACAACGGGAACCTCAGCAGGCATCTCAGCCTCCTGTTGCTGCACTTCCGGGGTGGGGACAACCT
CCGTCTGAGCAGGAGGCATCTTCATGTTCTTGATCTCTCCCACAACCTCCTTCGCGAACTCGCTGATGCCCTCAGCAGCGCATTTAATTCCTTCCGTGGT
CTCCTTAACCAGCTGGTCGAACGGGATCTCCTGGATGCTCTGACGAGCAGCGTAAAGCGACTCGCGGGCGTCGTTAGCCACCGTCTTCAGGGCTTCGTTC
GTCTGGTTCAGACCCGTCTGCGCCTTCTGCTGCGCCTTCTCCGCCCACTGCTCGTGCTTCACCTTCTCCATCGCCACATTCAGCGTCTCCACGAGCTTCT
CGATCGCCTTGAGAATCGGATCCGCCACGTTCTCTTGGAAGGCAACAGCCGTGCGGGACACAGCCTCAAAGCGCAAGGACTTGGCTCCTTCGTTGCCGCT
CAGGAAAACACGGCAAGCCTCCTCGTACTCGGCCTGCGACGTCACGTTGAGGCAGTCGCCCTCGGCGTCCGTGTACTGCACCACGAAACCGCCAGGCGTC
AGGTTGAACGTCTCGGCGAAGAGCGCGGTCAACGCCTCGAGCGAGAACGTGGCCAGGTCCACGCGTAGGCGGTGCAGCTCCCCCTTGTAGTTGATCTTGA
GCGCAGTCTGCTTGGCGTCCATTGTTGTTATTCTGAGGTTGAAGCTTCTTCTTCTCTCTTGCTGTCCAGTTGGGAAATGCCAAGAAAATCGGGGAAAGAA
AACGAGGAAAACCCTCGCCAATCTGTTTTTTGTTCTCCGACGTCTGTTCGTGGGCAGGATTCAGCCAATGAGAGAAGGGCGGACCGATCAATTTTTCTTC
GAGAACCCGATATTTTTACGAGAATTGCGCAGAGGAAACGGATGAACTTCGTACAGGCAGTCGTCACCACTCAGCAATATTCAATCAGTGCACACATACT
GGATACCAGTTTGCAGTTAAGAATGCATGTTAGGGAGCGATGGGAAAAAGTATCCTCGCGTTGGACTCGCCTTTTGTCGCAGACGTCCTTACCCTGTGTG
GCGCACATCT