Description :
From Genome Similarity Track
Location :
Scaffold_1:75431- 79899
Transcript NameFunction/comments
Sapdi_VS20SDRG_00024hypothetical protein
Sapdi_VS20SDRG_00025TKL protein kinase

Sequence
4468 bases(100 bases per row)
AGCACGACCAGGGACAGGGCAATTTATCCGGTTCCCGCCGGGAGGGCGGTTTCGCGCCCGTTTTCTCTTCACGTGGGAAACGTGCATTTTACGTGAGAAG
CGTGAAAAACACACGTGGGAATTTCTTTCGTTCTTCATCCCACTATACGCGCGGCGCGCGCGGTTTTTTAGGCCTGCGACGTGTGAAACGTCAGCGTGTT
TCCAGCCACCACCCGGGCTTCGAATTTCCGCATACGGTATCCGGATGATTGACCTCGCGTTTGATTGGTGGAATTGCGCGGCGAAATCCAAATCCCGCGA
TCTGATTGGTCAAAAACCTGTGGCCCGCGCACCGAATAATCCGGTCCAAAGTTGATTTGGGTTTCGTAGTATAAAGTCCTGCGATGAAGCGAGCGCACGA
CGACGAGGACGGGCGCCGGGCCAGCGCATGGACCGGCTGGACGCGCGTGCTAAAGCATGTCCCGCTGCTAAGCTCCTTCCTAGGCGACGAGCATGAGCCC
GCGCCGGCGCCGCCCACGCCGACGCGCCGCCCCAAGTCGCCGCTCAAGACGACGCCGCTCTCGCCGGCGCGCCGGTCGGGCTTCACGTTCGCCCGCATTG
GCCTCAGCGACGACCAGCCCGAGACCGAGACCAAGGCCGAGCCGGTCTTTGAGTTTACGCGCAAGACCAAGACGCCACCCAAGAAGGCCCGCAAGGTGCT
CGACTCGAGCGTGCACGACCAAGGCAACGACGACGAGCAGTATGTGCCCGGCACGTACTCGGAGCCTGTCGTGCGGTACGCGCGCGCGCGCACGGACGAG
CCGCTCGTGCCGATCAACTTGTTTGAAGAACGGCCGGCCAAGCAGGCCAAGCTCTCGCGCGGCGCGTTGATCAAGTCGTATGCCCTTTCTCGCGAAGAGC
GCCGCCTGAAGCGCCCGGCGCCGAGCCGCCTCCTCGCAGCGCAGTCGATGGACGAGCGCCAAGAGCACGCCAAGGCCGTCACGGACCGCATCCTCGCGAC
GCTCCAGGCCCTCGAGTCGGACCCGCTCGCGCAAGAGGCCAAGAAGCCGCTCCCGAGCATGAGCATGTCGTGGAAGAAGTACCATCTCGAAGTCCAAGAT
AACACGGCGACGACGAACGACGTGGATATGTCGAGTAAGAGCCCCAAGACCGCGTTCCCGACGCAGAGCCTGCCCATCTTTGCTCCGCAGCCGCCGGTCG
TCCAGCCGCCGACGTCCGTGGCGCCGCCGCCCGTGCTCACGACCGTGACCGTTGCCTCGACGCCTGCTCCGTCGGCGACGCCGGCTCCGGCGGTCTTTGT
TGCGCCCAAGCCGGCGACTACCAGCGTGCGCAAGGCCACCGGCAACGTGTTTGCTTTTGGCCTTCCGCCCAAGGACACGGAGTTTACGTCAAAGGAGTCG
CTCCTCAACGTACCTGTCGCGTACGCCTTCTCCAAGCCGCCGTCGATGAAGGTCGCCCCCGTGAAGGCGCTCACGTCGCAGAAGCCGGCCGTGCAGCCCG
TGCAGGTCGTGCCCACGGCGGCCCCGGTCACGTCGCCGCCGACGTTCTCGAAGTCGACGGCACCTACAACGACGAGCACCGGCTCCAACCCGCTCGACAA
GTTTAAGCAGTCGGCGCCCGGCGGCTGGAAGTGCCCGTCGTGCTACGTCGCCAACAAGGACACGCAGGTCAAGTGCCCGTGCTGCAACACGGACAAGCCG
TCGGCTGCGCCCGTGGTCGCTGCCCCTGTCGCTCCGTCGATTACTGCACCCGTGGCGTCGACGTCGGCGCCGGCGCCGGCCATGGACAGCAGCAACCCGC
TGGCGCGCTTCTTGGTCCAAGCGCCCGGGACGTGGCAGTGCCCGGGATGCAAGGTGCACAACAAGGCGGCGCAGGCCAAGTGCCCGTGCTGCAACACGGA
CAAGTCGACGGCCGAGCCTGCCCCGGTGGTCACCAGCGAGCCGGAGTCGAAGAAGAAGCGCAAGGCCTCGGACGACAGCAACAGCGCGCCTGCCAAGACG
ACGTTTGCATTCACGGTACCGACGACCGATGCCTCGGCGCCGGTTGATGTCACCGACAAGCCGCTTCCGACCTTTGGCTTTAGCGCGCCGGCGGCCAAGA
CTGCGGACGCACCGTCGGCTGGCTTTTCCTTTGGCATCTCGTCGACCGACAAGCCGACCGACAAGCCTGCTGCGGGCTTCAGCTTCAGCGCTCCCGCGGC
CGACAAGCCGACCGACAAGCCCGCCGCCGGCTTCAGCTTCAGCGCTCCCGCGTCGGAGAAGCCGACCGACAAGCCCGCCGCCGGCTTCAGCTTCAGCGCT
CCCGCGTCGGAGAAGCCGACCGACAAGCCAGCTACGGGCTTTGGCTTCAGCGCTGCGACGACCGACAAGCCAGCTACGGGCTTTGGCTTCAGCGCTGCGA
CGACCGACAAGGCAGCGGACAAGCCTGCTGTAAGCTTGGGCTTTGGCGCGTCGACGGCCGAGAAGCCATCGACGGGCTTTGGCTTTGGTGCCTCGTCGCC
TGCGGACAAGCCGGCGGAGAAGTCCGCGACGGGCTTTTCGTTTGGTGCTGCCGACAAGCCGGCGGACAAGCCTGCTTTGGGCTTCGGCTTTGGTGCCACC
ACGTCGGCCGCCAAGCCGGATGAGAAGAAGACGGCAATGAGCTTTGGCTTTGGTGTCGACAAGCCCGCGGATGCCGCCGCCAAGCCGGTGGAGGCGGACA
AGCCCGCAGAGAAGGCGACCATGTCGTTTGGTGCATTTGGCGCGACGGCCGACAAGGCGACGACCAGTTTTGGCTTTGGCGCGGCGACGCCCAAGGACAT
GACCGAGACGCCTGCGGCCCCAGCACTCTCGTTTGGCACGGCGTCCTCTGCGCCGCCTGCCGACAAGGCGCTTTCGTTCGGTACCGACAAGCCCACGACG
TCGCCATCCTTTACGTTTGGCGCCAACAAGACAACGGCAGAGGCACCTGCCCCGTCGACGTCGTTCAACTTTGGCGCGTCCAAGCCGACCGACTCGTTGG
GTGCATTTGGCGCGACGGCCGACAAGCCGGTGACCGCATTTGGCGACAAGCCCACGTTTACGTTTGGCGGTGCGTCGACCGAGAAGCCTGCGTTCAGCAC
GCCGGCGACGACGGAAGCGACTCGCAACGCGACCTCGTTTGGCTTTGGCAGCAGCGCCCCAAGCGCCACGACGACCTTTGGCGCGCCGTCGTCGGCTTCG
GCCTTTGCGTCGCCGTCGCCCACGACCGCCTTTGGCGCTGCACCACCGGCGGCGTTCAACCCCACTGCCTTTGGTGCTGCACCGGCCGCGACGCCGGCGT
TCGGTGCCCCAACGGCGTCAACGGGCTTTGGCTCGTCCTCGGCGTTTGGCAGCAGTGCTCCTGCACCTGCCTTTAACGCTGCGCCGAGCTTTGGCGCCCC
TGCTCCTGCAGCGGGTGCTGGCTTTGGCGCGGCGCCGGCTCCCTCGGCTTTTGGCGCCCCGACGGCGTTCGGTGGCAACAACAACAGTGGCTTTGGCGCG
CCGGCGGCCTCTGCATTCGGCGGGGCCCCGGCGTTTGGTGCGCCAGCGGCCAATGCTTTCGGTGCTGCTCCTGCGGCTCCGTTTGGCGGCGGCTTCAACG
CAGCGCCTCCTGCTGCTGCGGGGGGTTTCTCGATGGGCCAAGCGCCGCCCAAGCAAGGCGGCGGCCCGCGTCGTATTGTGCGGGCGCGCTCGGTACGCAA
GTAGGTAAAACAAGTAATATTAATATAACACGCAGCGGGGTTTGCCCTGTCCTCGGTACGACGCTGGCTTTGGTGCACTTGTGAAGCGAGCAGAGGTTGA
GGGTCCTTGGATCGGTCCATCGTCAGTCTGGTCGTTGGTCGCTTTCACCAACAACCGTTGCGGCAGGAGCAGGCTGCCGACTGGACCTGCAGAAGGTACT
AGTATTGGACTTGGTCGTGCTCGCAATTTACAGCGCTGTCGACCCTGTCGGCTCAGCGTTTGGACGGCTACGCACTCGGGAAACGCTAGCAAGAAGTGAA
AGGTATCGAGACCCCATCCACCGACACCAAGTTTATTCATCAACAATCACGTGGGAGATGAATGGATTCAGGAGCAACATGTGATTCCTTGGCACCGCAA
TAGCTACGGCAATCCTGTGCAATCCTGTATCAACCTTGCCAATATGACCCTGCAGACTGCACTTTGCAATTGAATATGCTCTGCGCGTTCGTCGCCACGG
CGCTCGCTGTCTTTGCTTCTGCAGCCCCCGTCACGGTCTACGATCGCTCCGACTTGAACGGCTACGCGCTCAGCTTGGACGTAGCAGGGCTCACGAACTT
GACAAGCAGCTGGCAAAATGACATCAGGTCGGTCCAAGTGCAGCCCGGCTACGTCTTTGTGACCTACTCCACGGAACTTTGCGACTTGCATTTGACGGCT
ACCAATGCGCTCTTCTACATGGAGTGGATGAGCTCAACACCAACTCTTGGCCGCATCTGGCAAGCCCA