Description :
From Genome Similarity Track
Location :
Scaffold_180:75411- 76783
Sequence
1372 bases(100 bases per row)
ACGCTTCTAAAGGCTGAGACACCCTGAAAAGCAGTCTATTTTACACAGTTCTGAGGTAGCACAACGGGATGTTTCTAGCAGAAGTGCCGAAACACCTACC
CGCCGATAGGGGTACCAGGTACGAGATTAACTTGGAACCTGGAACCAAGTATTTTGTGACCAAACAGTGACCATTTCCGAAGGAACATGTTGAATCCATC
AACCATTTCTTCAAAACGAGTGCCAAGGCTGAACATGTACGTGAGAGCAGGTCGCCTTACTGTATTCCGAACTTTGTGTGCGTAAGGCAACAGGTGGTTG
CTGCGTAGTTTATGCTTACAATAAGTTGACTTGGCCACCGTCCCTACGAAAACAACGATGCCACGGATATATGTATTATTGAACTCAATGAGGAAATCAA
CAATCTTTTCCGCATTGTATCTGAAGAATGGTTACAATCAAGCACTAGTGAATAATACCGATGTAGCCAAGATGGCAGTTAGCCCCTTAGCGGTATGCTT
TGGAAGTGGCTAGTAATGCCGCAAGGGCTGAAAATTGCACCAGCGACATTCAACCGGGTGGTTGCTCATGTGATGCGTCCACAACGTGCAACGCGCCTTA
TTACTTTGAAATTATGTTCTTTCATAAGAAGCACAAGGATGATTTGAGTGAGATTGATTTGCACAAGCGCCCTTTAAATATTGTGTTGCAGACTCTAGGA
GACACCTAAATGCACTTCATCGAGCAAAAGGGCTTAGTAGAGATTCCAGAGATACATTTGCTGGGCTTCATCGTGGAAAAACACGGAGTCGGTATAGACC
CTGAAAAGGTTAAAACTAAGAAATGGCCAATCTCACGACATGTGTAAGATACGTCAATTCCTTAAGCTTCTTCTCTTCCTAATCACTTGCATACATACAG
CAAGAATTAAATATAGCGAACCAAACCAATGTCTGACCTCGTTATAAAAATTGCAGAGTGGATTTGGTCTAAGGCTCAAGTAGGTTTTTTACATCAGTAA
AGCAATCACTTGTAGAGGCTACGGTCTAGGCTTTTCCAGACGCGGATACACACTTAAGCGTTGTCTGCAATGCGAGTAATTTCGCTATCGGCAGTGCACT
TATGCAAAAAGATGACGACGACATTGACCGTATCATCTCGTATCAGTTCCGGATGTGTGATGTTTCGTGTGCAAACATTTAGATCCGAACCTTAAATTCG
TTAGACGGATCACGTATCACTGCAGACCGCGATGAAATCACCGCACATATCGCCTGAGATGACGAGGTGGCTCAAATTCTTCTTAAAATTTAATTCTCGG
GTTGCATACAATCCGGGGAAGTCTCATATATTCGATGAAGCGTAATCGCGCCGACCAGACTTCGAGGAACGA