Description :
From Genome Similarity Track
Location :
Scaffold_94:75407- 80222
Sequence
4815 bases(100 bases per row)
TGACGGTAAAGACATTTGAGGGAAAAGAAGGGGAGAATCTCCTCTTGTGGATCAGAGAAGTGGAAAAGGCCATGAACTCTGCTATGCTCCGATTGGAGCA
ACAGCGAGTTGAGCTGGCTATCTCAAAACTGGGTGGTAGAGCCAGAGAATGGGCTCTCACGTTTAACACGCCGGTAGACGAAGTTATCCCCACATGACAT
TTGCTAAAACAGCAAATATCCTGGGTGTTTACTCCGCCTAATCAGGCATACCAGGTGCGTTCTCGTTTCCTATCTGCCCGTCAGGGCAAGAAAGAACTAA
CGGATTATGTCCAGGAGCTGAGACCTCTAATTTCTGCCATGCAGATTGATCCCATACAAAAAATGGTTCTGGTTACCATCTTCATGGAGGGTCTTCGTAG
TGGCGTGTCTCGAACGGAAGTATTCCGGGTCCACCTCACCTCCTTTGAGTCGGCTGTGCATATCGCGTTGATCACTGAGTTTAACTTTAAATGTAGCCCG
TTTTAACACCCATGGGTACAACCCAAACTAGGCAAACTCATTTGTTTCGTTCAATAGGCCGGAGCCTATGGGCTTCAGTCTCGCCGATACGGACGAAGAA
GCAGAGCTTCGAGCTGTAGAACAACATTGTAACATTCGACGATGTTTCACGTGCGGAAGCACGAAGCATCTACGACCTAATTGACCCCCCAGTAGGCGCG
GAGCGCCCTGATGGGGAAGAACTAGGTTCTGTTGAGCCTCTAGGAGGTAGTGGAGAGCAACACTTAGCTCCAAGGAGTCCCGTACACTCTAACACGGGGC
GTGAATATAAGTCAGTCTTGTTGGTCGCAAAGGCGACTGTTAAGGACTTTGACAAACCCTGGTCGATTTTGATCGACTCCGGAGCATCCATGTCAGACTC
TGTTTACTTGAAGGGAATCCACGTTATGTTGAGGCGCTAGAAGCGCACAAGGGTGATACGATCACTGTTCGCTTGGCGACGGATACTCTAGTCACTGCAC
CCAAAGTTCCTATGAACTTGGGCGTGAAGTTTTTCGATTTCGATAGTATCAAACTCTGTTCAGTCCTTGATTTGGACTCGATATGTAATCTCATTCTTGG
TATGGCTTGGCTGGAGAGCCATGAGCCAGGGATCTACTGGAGGTCGAAAAAACTAGGCGCCACGCGCACTGCCCCTAGTGGAGCTTTGGACCCATGAACC
CACCTCTGCTAGGAATCAGAAGCGCTATTGGCGGGAGCCACTGGCTGACAATGTCAGTGAGCTGGACATCGGAATGTCAGAGTTAGTTGATTCTGACGAT
GTCAAAGACATAAGTATAGAGAAAAGCTCAATATGTGATAGTGAAGCGACACAAACGCCGCTAAGTGATAGTCGTTGTGAGATCAACGTACTGAATGCTG
AAAGCATTGTTGACCAAGCGTCAAGTCATAGAGGGTTGAACCCATCAGATGAGCATGGAGTGGCACGTAAGTACCCACTGAGTGACGTTGACTGTGATAG
CGACGCGCTGAATGTCAATATTGACGGTGTTGGTGAAATAACAAGGCATCCCGAACCCGGCTCAGCGGATGCACATGAAGTGGCACGTAATCCACGTTAT
GACGACGTCATGTCCAATGACTCGTCATCGGATGTCAATAGTGACGTCGGCTCTAGTTTAGAGCAAATTACGGTTGATGATGGTATCGATCAGAGAGATA
CGAATCACACATCGTGTGCTGTGTCACAAAGTGGTGATGGCTGTCAGCTGTATACACTCGTCAACGGAGTGACTGGTGCCTGTGATGGTACAATTATCCT
TGAGGCTATACCTCGTTAAGTTCGCTTTTAAAACTCGAAGAGTTGTCGGACGATGAGTTTGATCACTCACTAAAGAATGAAGACCTTTCAGAGATGGTGG
TCATTCGACCCGACATCATAGAGTTGAACTCTGCTTCACTTTTGGATGAAGCCGTTCTGGAGGACACAAAAGTGGCACTCAGTGCGCGTACTGGGTCATC
AATATCGAAAGACCTTCATGATCCTTTTTATTCCTTACTGAAGGTATTTCAAGATGCCACGACCCACCCTTGGTTCTACCTCCAGATAGAGGTGTCCGTC
ATGAAATTGACTTGGTTCCTGAGACCAAATACTGTGCCACACGACAGTGGCCCTTGCCTGAGAAGCAATGTGATGTCATTGATGACTTCTTCCGTGCCAA
GCACGAGGCAGAAATGATACGTGAGAGTAACTCTCCACATTCGACACCGACATTTTGTGTCAAAAAGCCGAACGGCAAGTGGCGTATTGTGTATGCTTAT
AACAAGCTCAATGCGGCTACGATTCCTGCCCATATTTTCATTCCTCGAAAGGATGTTCTTCAAAACAATATGGTTGGTTGTACTTTGTATAGTGCACTCT
ACTTAGTTGATAAATATTATCAACTGCTCATGCGAGCGAGTGATTATCCGATTACAGCAGTGAGCACTCCTAGTGGTATGCTATGGGAATGGCTGGTGAT
GCCCCTGGGGCTGTCTAATGCTCTGGCAACATTTAATCTTCTGGTGACGCAACTTTTCCGCCCACATAAGGATTACGCACAGTACTTTGATGACATTTTT
GTCCATACTCGTGCCGAAAAATGTCGGTCAGATGTTGCAAATCACATCAGTCATTTGCGAGCCGTGCTCGAGTGCATGCGCGCTAATAAATTGTACGCTA
ACACGTATAAATGCATTTTTGGTGCAGAATATATTCCTTTTCTAGGATTTTTCATTGGTAAGTGCGGCCTTAGTGGATCTCGCTAAGGTTAAGACTGTAG
TGCACTGGCCGATTCCTAAGAATCAAAAAGACTTGCGTAAGTGGCTTGGCCTTGCCCATTACTTACACAAATACAGTGAAAATTACGCTGATATGGCTCG
TCCATTAACTAATCTCCTTAAGAAGGACACCGATTGGCGCTGGGACAACACCCATGCTGACGCATTTCGGACAATAAAGGAGAGTCTCCTCCATTCTCTC
ATTTGGGCTTTGCCAAATCCTGAGTACCCTTTCAGTGTTATCTGCGATGCATTCGACTTTGCAATATGCAGCGCTCTGATACAAACAGATGCTGCAGGAC
GCGAGCGAGTTATCGCATTTGAATCTCGTCAGCTGAAAGCTGCTGGAAAGAACTATCCAGTTCATGACAAATAGCTACTTGCTATGAAGTATGCGCTCGT
CAAAGTCCATCTGCTTGGATCCAAGCCATTCGTAATCTATACGGATCAGACGTCCTTATGCACGGCGACACAGTTGCCTCACCTCTCTCAGAGAATGGCT
CGGTGGCTTTCCTTCTTTACAGAATATAACTTCGAGGTCAAGTATAAGCCAGGCAAACAAAATGTGTTGGAATATGCCCTCTCTCGCAGAACTGATTATG
AGCTTGCTCATGTCACGACTTTGTCGTCTCCTATTGAGGAGTTAATTCGTGTGGCACATCCACAGGATTCTCAGTGTGTGGCATTGTTTTATGCTCGTGG
CAGTGACGAGTACAAAGACTCGAACACCTCTTTTTCTACACGTTTGCGTGCCAGCCTACATCAATATTACATCGATAGTGGTCTCTTTTGCTATCGACGG
ATGCAACGATAACTCCTCGCGTTGTCGTGCCTCACAATGAGGATTTAAAGTACCTAATCCTCTTCCAGGCCCACGATACTGCCCTCAGTTGGCATTTGGG
CCGGGAAAGACTTATGGCTCTGTGAGTCAACACTACTGGTAGCCCAAACACTACAAATGGGTGAGCACATTCTTGCGCACATGCGAAACGTGCCAGCGGG
TCAAAACTCGGCACATTCGGCTGCTTCACTCGCCAGTTCACCTGTGACCACGGGGTATTGGGATCCCATCAGTATATATTTTGTGTTTGGTCTTCCCGAA
TACTGTGACGGAAATACGGGAATTGTGGTCCTATGTTGACTGTTTGAGTAAGATGGCTCAATTAGCGGCAGTGCTGGATTCCGTCGATGGCAAAGGTACA
GCTATGCTGTTTATCGATCGTGTGTTTCGTCAACACGGGTTGCCGCTGGTAATCATCTCTGATCGCGATCCTCGCTTTACAAAAAAGTTTGGACTTCTAT
CTTCAAGGTGCTTGGCACGCGATTTGACATGCTCACGACGGATCATCCGCAGACGGATGGTCAAACTGAGCGAGTTAATCGCGTAATCGGCGATGTTCTT
CGCAGTGTTTGTGCTGATTCGCCTACGACTTGGAGCTCGCTCCTCCCTGTCATTTAGTTTGCGTTGAACAACGCTGTTCATGCATCGACCGGCTTTACTC
CCTTCTATGTGAATAGCCTCACGAACCCCGCGTTCCGCTCACGTTACCACTACGTGGTTCTGGGCTTGGTGGGGGAGAGTCTGCTGACAAGCTTGCTGAA
ATCAGCCCTACCACGATGCAGAAACAAGTAAGCGAGTTCCTCGCGACGCGCTTTAGTGTCTTACGACATGTGCGTGATGTAATGGCTGATAGCCAAGACG
AACAAAATGAACAAGCTGATGCTAAAGGCAGAGGATGTATTGATTCTCACGAAGTTGGAAACCAAGTCTTATTAAATGCTAAAAACCTACCTTCAAATAT
ATTGTCTGCCGTCTTCAAGACGAAATTGCGTCCGCGCTTCATTGGACCGTTTACGGTCATAGCGAAAAAAGACCTTGCATATACACTCAATCTCCCGCGC
AAGTTGCGCACGCATCCAGTATTTTACGTTGGCTTGCTTAAGCCATATCACGATCCTTCTCTCGTGGAACGGAAGGTGCTTGAGACTGAGGGTGGGACGT
CGTCCCCGCAAGCTG