Description :
From Genome Similarity Track
Location :
contig_23:75407- 77005
Transcript NameFunction/comments
g6264.t1hypothetical protein

Sequence
1598 bases(100 bases per row)
AACGAACGCACGCCTTCTCCTTTCCCACACGGAGACTCGACGCGCAGTACGCGGTCAAGAAGCGCACCCCCTCCCTCCCTCGCACAATGGCGGATGAGGC
ATCAGCAGCGGGCGGCATGCTGGACAACGGCGCCATGGTCTGGGTGCCGCACGACGAGCACGTGTGGAAGAAGGCCGTGGTGGTGCGTCGCCTAGATGAC
GGCGTGAGCGCCGAGGTGCGGCTGCAGCCCAACGACGACGGCGAGTGGGACAAGGACGACGGACTCGAGAAAATCGTCAACATCCGCGACATCGCGCGCC
TCGCCGGGGAGGTCTCAGACGAAGCTATGCCCATCTGCAACGTGTTCGAGGCAGACGGCGCCAACGACATGTGCACGCTCAACCACCTGCACGAGCCGGC
CGTGCTCAAGAACCTCGAGCTGCGCTTCGCCAAGAAGATGCCGTACACGTACACGGGTGCTATCTGTATCGCCGTAAACCCGTACCAGTGGCTGGACCTG
TATGGTCGCGAGCTGTACCTGCAGTATCTGGAGCAGCCGCGCGACTCACTTGCCCCGCACCCGTTTGCCCTCTCGGCCACGGCCTATTTGGACATGAAGC
GGACGCAGGTGGACCAGAGCATCCTCGTGAGCGGCGAGTCCGGCGCCGGCAAGACGGAGACGGTCAAGATCATGATGAACCACCTGGCATCCATCTCTGG
GGGTGGCAACCACGGCACCAAGGTCATTGAACAAGTGCTCAAGTCCAATCCGCTGCTCGAGTCGTTTGGTAACGCCAAGACAAAGAGGAACGACAACTCG
AGTCGCTTCGGAAAGTTCGCGCAGCTGCAATTCGACACCCTCGGGTCGCTCGTCGGCTGTCTGTGCGAGACGTACTTGCTCGAGAAGAGCCGCGTCGTGG
GCCAGACTGAGGGTGAACGCAACTATCACATTTTCTACCAAATCTTCTGTCTCTCGGAGGAGCGCAAGTCCAAGCTCAAGCTGAGCGGCGACGTCACGAG
CTACAAATACGTGACGGAGGGCGCGGACGCCGAGCTCACGGGTATCGACGACGTACAATGCCTCAAGGAGACACAAGAAGCCCTGGATATCATTGGCATT
TCGAAGGAGGAGCAGAACGGCATCTTTGAAATTGTGGCGGCGATTCTGAACCTGGGTGAGGTGGAATTCGAGGCCAACGGCAACGACAACGAGAAGTCCC
ACGTGAGCAACGAGAGCATCGTGGACAACGTGGGTGCCCTGCTGGGCACTGAAAGCGCGGCGCTGCACTCGACACTTCTGGAACGCTCGATCACGGCCGG
TTCCGAGTCGTACACGATCCCGCTAAACGCCGAGCAGGCCTCAGACCTGCGCGACGCTTTGGCGAAGGGCATGTACACGCAGCTGTTCGACTGGCTGGTA
CACCGCATCAACAAGGCTATTTGCTCCACGAACAATGTGAAGACGCACATTGGCCTGCTGGATATCTTTGGATTTGAGAGCTTTGACCAGAACGGCTTCG
AGCAGCTCTGCATCAACTACGCTAACGAGAAGCTGCAGCAGAAGTTTAACAGCGACGTGTTCAAGGATGTGCAGCAGGAGTACGTGGATGAAGGCATC