Description :
From Genome Similarity Track
Location :
Scaffold_38:75406- 79731
Transcript NameFunction/comments
Phyca_LT1534119485type I inositol3 putative

Sequence
4325 bases(100 bases per row)
tacgaatacgcccgacttccacctcctgtgccaggcggacattggtaatcctgcggcaacatgtagttctggagcgcactaaagcagtattgtgctttgc
caatgttctttcgtgcattttcacggcgaacaccatacgtacgtaggagatttgtgaaggcctccatgtcgtcagccaaaaggccatgcgagcgtacaag
taggttggcttcctcgagagtgatcgacatggatgtgcggtctttggccgatttgcacatcgtcacacggccgcccccaacggatcgggcgatagaggat
gacaaactgagaatggccatacgcttggatcgtccggagagctggatgttgcccttgagagccatcagtgacgtatggatgcgatcaaggtcctctgcgt
cataaattggagccgacgcctgatctctgcgctgcttcttggaaacccattctgcgaatttgttaacgtacgcctccaattcgaccacgttttcggcatt
gatttccttctgtagcgaatctttgccgactgtgttcgcaaccgtctgcatttcattcatcccctgcgagaagaccacaggtactacgcgaattagtctc
tggaacaagaactttgcacgcatcttctgctctggcgtcgatagcgacaaataaatggctcccgagactgcgtcttgccccggaactcggtgcatactac
ggtcagggaaatcgcttgcacggcgtgtaatgatcggcagctcgattatgatgcctgaaggtccagaagtgatcgagacacggaaagcagcagcgcgcgg
agattttacaggccgcagcttgatgtgaactcgtccgagctctttgacagcttctaccgtgtcacccagcatccctaattcattaccgtaagttgatagt
aaactttccaccgagaacaaaaagccaacccgtgtaagcatttcgagataatcaatgccacaggctttcaaagggtgagggccaaaatcacggtggtcgt
gcgtatgcacgtataacgtttgctggaaacatgtaacaagtgcactcatcgcctggcaaaaagccacttcaagccgccgctccacgtcccatttgagctc
gttgtacttgcgttcgagcgcgttcattgtaagatccgagcttgcttgagcttcattcactaagcgtacatgcagtttttccagctcgtcgcgcttttgc
cgaacaccacccgtcttaaaaccataaacatgggcagcaaaagcaccgaccgttgtagtaccgtacattcggtgtttgtaaaaaggaggcctgccttttg
cattcgtatcaatccgcatcgatgccttcttcacttccgctccagacatcgatccttgcgaagatgataggtttccactattcggctccgcatcatcgct
atctaacccgcttaagatgacatcggctacaatatcgatcgcatcagaagaatcaacgttggcatccagtccgtagatgctctgaaactcttcttcagta
attcccattgcaacaatggtttccgctaactttcgctgctccgaaggaaccgaaacatcttgcccagcagctcccttgttgacaattgtttctgcggaat
cgaaagaaatcacgcgccgacgtagtgcctcaacaggttccaggggcgattcttcggtcggcgataataattcttctttttcatccttgatatcatcatc
taaaaattgcacgaaatcacgcatgcttgactctctcgacagctgtaagggtgaggccatgacactccccacgaatgagttcacgagacgagcataacgc
attgcactggtttggtcgccaatttggacatccttttctgatgtaggatatgcgttgcccactgtcatcagctgctggtgaaggtttagcgcgaggaagc
gcaaatcggcatctgctttcatggtgcttggtttgaatgtaagtccagcgtgttgtgtagctccatacctcagaatcgagtcctccacctccgaaatgta
ttgctccatcgtcttgacaagttctaatcgccacttccgctttttccgctcgacaacatcatcttgtatctgaataatcatctcagacagcatcccgatg
ctagttgctggtctagcccggttctcaagagtaagcgaagagctcatgccagaagtagtcgatttcaacgattctgagccatcaggcgactggagtggat
gggttgtgtcatgttcccgcacagtgccaagggatctcggagaagctgggatcaccgaggggaacgagtagccaccaacactcggagttgacagttgact
agaaggagtcgatgaagagctgtcgtcgccatcctcgatcgcgatctcgcgttttagagaatccagtttcaccagtaagtcggataggatcaactgcaga
agctgataaggtacctcccacgtgtatacactttcgatcagctcttcttcgactagcattttaccttgcattcgttgggaggtagacgcaagattaatca
tttgctgagcgatctcggaatacactgaaccatcatgggctgaatcatcctccacatcggcacttttacatccaacatacatgaacgaccgagtgatgcg
ttcaagtccaccggtagacattccggtatgcaaaccttttacttcggcttcacaccggataacgatttcacccgaagatcgcgttcgagataaaggggaa
tataacgaaaaaatagctgcccgtccgattgcgagggttgaccccatcataaatgatgccagcggaacaagagggtcgccaacaagccactgactattca
agtcctccagtgagttcaagtttcgaaccgagtacactgaagcacggagcaaatcttgttcgcgcatttcaacagccagcatcatgtgaaagcatggatc
ttctgaataggatatttcagttcggccgatctccgctaacaccccacctgtctcggcattcatcaagtgcagcaccacgaatgatgatgacctcactgat
gacatcgagggtaacgtcaagttgaagcactgaaacgatagccatgcgctgggggtcggcgacccaggctgtactggccacctcgactcggttcccaatg
atccatccaccccgtctacctgtttagcttgcatctcgtaatcaaacgcgcccaatgatgagccagcactgcacgtgagatcaaacccagaagacctgtc
cagtggttgcttctctatactaccaccgcccaaatgctgtcgtacgacgtgctctagtcggcgtttagcccgatccagcacgctgttcccgagacctaat
gacagcgggctcggccgacggcctaccgctaaatatcgaccctgtacgcccggaggtgaattcggtcgtgtctcctcatgattcattgccgctaccagca
acggtcgagtcctcacttcctgctccagtagcggtgtggtctcagatgtcactcttccgttgttataactgagacttctcctagacgggatctctagcgt
gggctccacctcccacatcagcaccaaaaacagcacacagggtacaatctctggaatggcataacccaccacgatacacacgtctggactgtgaatatcc
ccgcagccttggtgcgagaagggcctctggatgtaaataattgtcctcaatagaaacaacacggagcagactcccatcacgaaaatagtgaacctgagag
ctctcgtcagtttcttctccactctctcgtcaagtctgcgtcgtagaccgtcccccgatggctttagaaccctctccactcgatggcgcatcttccacgt
ggagtacaacagccccaacgagcttgccaagctccctgttgcgacgagaagcactggcaagacacctgtccataacgtggacttcttaatcctggcttgt
gcatgtttcgcctcagccactttggcttcatggagcactgatagacctaaaactgtggcgtaaaataggccgttggacacgataaaggccacccagagtc
ttctagagcgtcgggagaccttggggttggcgatatccagccagaacagcgtctggaacagcacaaggctgaagaaaagacacagagaagctctgttcaa
caggttgcgcgccacatctcggcccaggaaagaagcagcgcggaagaaggcgaacagaaccatcagctgctggaacgtgctgcgttgagagcgctgagag
cgcgaagacagcgcgcgacaggccgccacgagcgccagcgtcaggtacactgtggcacatagaagctccagcccgggggacgcctgtggcaggaacacga
ggccgtcgtccgcagcttcagcttc