Description :
From Genome Similarity Track
Location :
contig_18:754054- 756811
Transcript NameFunction/comments
g4506.t1hypothetical protein

Sequence
2757 bases(100 bases per row)
GCAGCCGACAAGACTAGAGACCGCCTAGGGACTTACTTCACATCCAGTCCACCCTCGTGCTATCTGCAGGGACCCACGGCACCTCCAGCCAACGCGTGAC
GATGACAGATCCACCTTCTGTGGTCCGCCAAGTAGTGAAAGAGTTCCAGGCCCTTGGACCCTTCGAGTTGGTGCCTCCACGACCTAAGGAGACTTCGTAC
ATATTCAAGTGGGGGGTTCGTGTCAAGTACATCGAGAACGAGAAGGAGGTCTTCGCGTGGGCTTGTTTGGCCGACGAGGCGTTTCGGACGTCAGGAAAAA
ACCTGCTCAACTGACAAAACGACCATGGCCGTGAAGCACCTCCAGAAGATACACAACGTTGGTTCGCCGAAAACGGAGACAGCGACCGTCAAGAAGCGCA
GACACGATCATGGTTACAGCCACCTGTCATCGTCGCTCTGTACTCAATCAACCCAACCCGGCTAAACGTGCCGATGACCACATCAACCATAACTTGACGT
TTTGCATCGTGGAGTACGAAGAGGCAACACTCATCCAAGCGCTACTCTATAAGGACGAGATGAAGGCCAAGATAACTACAAAGCAGGCGAAGGAATCTAT
CGTGGAGCTGTATTTTCAACACGCAAGGAGATCACTAACTACCTCCAAGAGAACCGAGAGGACTACCTGAACTTTACGCTCGTGGCAGATTTTTGGACTT
GCAAAACAACGCAAGACAAGTATCTTGGGTTGCAGGTTTACCTGGCGGACAAGGCCTGGGAGTATATGTCCATTCTCTTGGGAACGAGAAAGTTCAACCC
CGCATATGGAGATCGTGATGGCGGCATTGTAAATCCCTTCAATGAGTGGCTGAAGCACATGCTTGAGGAGTTCGGCTTAGCGATGAGCGATTTTTATGGG
GCTACAAGCGACTCGGGAGGTGACGTGAAATCGATGCTGTGCAAAGTACTCAATCGGCACTGGGAGTGGTGCTCGCACACATGGCCCACGCAGCTACAAA
GTTATCATGTGGTATAAATGGAGCTGCTAGTGCTGCAGCTAATCCGGAGATGGCGGACTTAATCTCACGGATGGTAAGAACAATCTTTCGGGTCAAGGTG
GTGTCTGTCACTGGGAGCTTATTTGCAGAGCTCTGTAAGTCTAAAACTCAGGGTGCCTCCACGCGACTTGTTGGATATTCTACGTCACGTTTCCTGAGCA
TGACGCATTCATTGGAGAGATTTCTTGAGAAGTGGCCTGCAATAACTGCGTGGTATGAAGAGCGAGCTCGTAAAGCACTTCGTGCCAACCAGCCACCACC
AGAGTTCCCGTTGGCTAATCACCATGACGACTTGGTCCTTGTGTTGTCTGTGCTGAAGCAAATCGGTGAGACCAAGTGAACATGTCAAGCAGAGCATCCT
GTTCAAGTCGACGTGCTCGTACAGTTGTATGTAACGCGTATTCACCTGATCAATCTTTGCCACACTACCTACCAACCGACAAAAACCCTCGTTGGATTCA
TGCAAGTGACCTTACACCACTGGCTGCGGATTCACGGAGACTATTGCGAGAATCATTGGACGAACGCTTCTTCAGCTGATATTACAACGACAAGCAATTC
CACAGGTGTCAATTTGTATTTGAAATGCAGTTGAAACTCCACCCTAGCTTCAAACGAACGGAGAGGAGTCTCGATCGTGCAGTGATTTTGTCGTGCCGTC
AGCATGGCAAAAGCGGGAGGGATGCTATGACCAGGAAGAATGATGTGAACGCTAAAATCCGCTGCAACTTATTGAACTTATTTAAGTCAGTAAGTGAACC
CGCGGACGTCTCTGAATTTGAACCACCTCCACCTGTTGTGCAAGTCAGTCGACTGGAACCAGAATTTGCGCCGAGATCAGGCCGACCACCAACCTTTAGC
CGGTAGGATCGACGCGCAGAAGAGGAACTTGATCGATGCCAGGATGATCCTGTTGACATTGCACGAAAGGAGGACTACACACCAAAGGAATCAGTACCGT
ATCACAAATGTCATATCCAGCAACTTGTTGTATCCGACACGTCAAATTAGCCAATAGAATAGAGCAAATGTCATACTTGAAAACAAATGTCATATCCGAC
ACCAAATTGGTGGACAGCAAACCGGGACACTTTAATTGGACGGGAATGCAAGCACCTTCAGACTTTGGTATCTCGATCTCACTACGCAATGGGCAAGGAA
GACACAAGCCTTGCTGCAGATTGACCACGTCGTCGAACGCTTCGACAACCTGGGACTGCTAGATAAGGAGGTAGGTGAAGGGCGGAGGACCAGGACTACG
TTGACCATATAGTTAACAGCATTGAATACGCCGACGTTTAGTTTGATATCAACCTTGTGGAGCATTTGATGTCTCCCTACCCACGCAGGCGCACACATGC
GCATGACTCGAGCATTATCTTGTAGGACTTCGCTGGCCCCCCCCCCTTCCTGAATTTAGTGATGCCATTAGACCTACTTCGCCTTGGCCTTTTGTCCGGA
AGATCTGTCCCATTTAATTCCTGACTATTCCTCAAATCCGTTGCAAATGTTATTATCATATATGACAGGATCATCATTCAGGCAAATATCCGTGAATTTG
GCTGCTGGATATGACACTTGCGATACGGTACTTGAGTTTTGGCAAAGACTCGAGCACCAAGGCGACTACCGTATCATACCGAAAGCTGCGAGAGTGCTGT
TCTCAATACCAGTATCTTCGTGCCAGATTGAGCGTGATTTTGGTGTAAGCGGGCAGA