Description :
From Genome Similarity Track
Location :
Scaffold_6:75405- 78537
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_6-snap-gene-0.47Major Facilitator Superfamily (MFS)
Pytap_DAOMBR444snap-pag1_scaffold_6-abinit-gene-0.171Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_6-snap-gene-0.48Si:dkey-147f20.5

Sequence
3132 bases(100 bases per row)
CTCGTATtCATCGACCGCACAGGCACCGCCTCAGAAGAACCATCTGCAGTTGGCGGCATGTTTGATCGCGCTCTCGTCGTTCCTGTGGGGATATGGCGTT
GCTGTGTTGAACGTGTGCATTGTCCCGGACGCCGTGGGCTCCcTCCTTATTGACATCAACCTGACAACTGAAGAACAAGAGACGGCAACAGCCCTCGTGC
TGGTCGGAGCGCTCcTCTCTGCCTTGCTCACTGGTGGTGTAGGCGAGCGCATCGGCCTCAAGACGACGATTCTGCTCAATAACTTCTTCTTCGTCCTCGG
TGGAGCAGCGTGCGCGCTCGCAGTCTCCAAGCGTTCGATCTTCCTGGGTCGTTTTTCTATCGGTGTCGCGTGTGGCATCGTCACGAATACCGTCCCGATC
TTGTTGAATGAGATCTCGCCTGTATCGATGCGTGGCCAGATCACGTCTTATCATCAACTGTTGCTGACGACCGGCATGCTGGTCACCGGCATTCTTGGCT
TTCTCATCGTTTCAGATGTGCCATCAGGGTGGAGATACCTGAACGCGTTTATGGTGTTGCCAGCAGTAATGCAAGTCATCATGGTCGCGTGGATTCCCGA
GAGCCCATATTGGCTAATGAAGTTCAAGGGgAAGGACCACAGCCGCCGTACACTCATGCGTCTACGCGATGCACGCAACCGCGACGCGATCGAGTCTGAA
CTGTCGGATATCGCACTCGCAATGGAAACCGACGCTGTCGTCCGAACTGCCGAGTGGTCTGATCTCTGGGAACACAAGTCGGTACTGACTCTCGGCACAA
TCATGGTATTCTTCCAGGCGTACGTCGACCTCGCATCTGTGGTTGCATACTTTGTGGACGTGTGGCTGATCCATTTGTGTTTCTTCTTTGTAGGATGACG
GGCATTAACACAGTGATGCTGTACTCAGCCAAGATTTTCCACTTCGCGGGAGTTACGAACCCATTCCTTGCAACCAGCGTCGTCGGTGTCACCAACGTGC
TGATCACAATCCTCTCCGTATCGCTCGTGGATAAGCATGGTCGTCGCCCATTGTTGATCCGCGGTACGATGCTCATGATCGTAGCACTTCTTGTCCTCAG
TTCGAGCTTGCTTCTTCTAGACGACCATCAGAAGTTGCAGGCAGTATTGGCAGTCGGCGCTGTACTCGTCTTTGTGGCTGGATTTGCCGTCGGCCTTGGT
GCTGTCGTGTGGGTTGTGCTTGCCGACATCACTCCTGTTGAGATCCGCTCCCGTGCGTTTTCTTTCTTCATGGGCACTTCGTACGTGTGCAACATCGTTA
TTGCCGTATACACGCTCTCGGCCATCAACTACTTGGGCACTGGAAGCAATCCGGAGAAGAACGGAATCGCCAAGTTGTACATGATTCTGGCTGGTGTGGC
ATTGGTGGCACTAATGTTCATTACGCGCAACCTGCCCGAGACAGCCAAGTCCGGAACTAGAGACGCAAGAAGCCCATCAACTGAGGAACGCAGTGCGCTC
TTGCTTCCCAAAGATGATGAAGAAGAGTATGACCGAGCCAATACTACCGAACTTTGAGTCCCGTCATGAGAAACCTGGAGAGAACAGAGAATAGCGAAGA
GTAGGACGCTGATGTTCGTCAATATTTCATATCTTGCAGTCGAATTCACACGCTTTAAGGATGGGAAAGGgTCTGGATGGCGGTAGCCAACTCGTTGATG
GCCTTGGTGGTCGTCAGAATGCGTTCGCTGTGGTCGGCCGACGAGAGTGAGTTGGTGAGGTCTTCGAGTTTCTAGTCAGGTGACAGCAGTCGAAAGTTAG
CAAGCAAAGTCAATTGAAGATGCACACGACACCCAGCGCTCTAGTCTCTCCGGTTAGAAATCGTGTCGTGTTGACAGCAACTCTCAAAGATAAATACAGG
GATCGACTGGGTGTTCATGTCAGAAGAACGCAGGATGCTCCACCTTGTACAGCGACGCCAAGGTCTGGCGACGACACGCCTGCAGGAACTCGTCATCAGC
GGATGTCGAGAGCAACGCGTCCTCGCTTGTGCGCTTGACTGCTTGGGGAGACGAAAAGTGTCAATAAGGGTTGGGgAGGGGCTGGATATGACACAGATAG
AGCTAATTGTACCTGGAGCGGTTGGCGTCACAGCCGTCTGTGCTTGGCGCTGTTGTTGTTGTTGCTGCTGCTGCTGCTGTCGCTCGTACTGGAGCTGGAG
ATCACGCTCGCGTTGCGCCTGCAGCTTCTCGAGCTGTCCCTGTGCGAAGCGCGCCTTGATGAGCTGTTCTCGCTCTTCCTGCTCCTTCGCCTCGCGCTCT
TCTTCCTGCTTCTTTGCTTCTTCCTCTGTAATGACAAAGCGGTCACAGCCGACACAGAACATCTGCCCTTCCTTGTTGCGCATCAGCGGCGTGAAGCATT
CGTCGCTCGGGCAGTGCACCGCGAGCATCGTCCATCCTTGTAGCAGCTTCTCTCCCAGGCGAGCGCTCGCGTCATCGCGTTTCTTATACTTCTATTGCAA
CATGACCAGCATAAGCGCCGCCGCCGACTCAACACAGAGGCCAGAGGACCCACCGATTCCATATCGTCGTCTTCGTTTGGCACCAATGCTCCTGTTCATT
CTTGTGCTCATTCGATCATCATATAACAAAGGATTTGGGCTAAATGGTTATAGAGGTATGATAGTACTTTCATTTCCCGCCAAAGACCTCACGAGGAAAC
CAACACTAGAAGCCATCACCATGAGCGACGCTACACGGCCCGTGCGCGTGTGCCTCACGCGGTGCCCCCTCTCGGTTCCCGAACAGGGCATCCACTCCAT
ACCATGCCACATCCAGCACAATGGACCCGCTGCGATCAAGAGCtATTtCCGCCcaGAGCAGGTTACCGATGAGAAGACGGCGAACACGTCTTGGCGCGCC
GAGTTCCGcGGCGTGCAGCTGCATGGGCAGAACGTAAGCCTACAGGACATGGGGATGAAAGGTGTGTCTGCGTCTGGTTGGTGACCAGCATCTGGATCGT
TTGTGGCTCATTACTCGATGCACGTAACCATTGTAGGACTGCTGCTCGAAGATGCAGGGATGACGCACCAGGACGACGAAGGAATAATCTGGGAGGTCGA
TAGCCACTTCGACGAGCTGACGTTCTGGTGAG