Description :
From Genome Similarity Track
Location :
Scaffold_1737:754- 3866
Sequence
3112 bases(100 bases per row)
CCGACTCCCACCCATGGATCCTCTCCCTACTCTTCTTCGTGAGACGCCGAATCGGTTCCGATTCGTACGATCCCGCAGGAAATCACAGCGTAATGCTCCA
CAGCTCAGATTTGCCTCGTCTACCCAACTATGTTTGTCATATCCACGCCAATACACCAGAAATCCGCGGTAACTGCGTCCATATCTGGTTCGCTTCCCTG
ACCTCATGTCGGAGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACCACAGGGAACAGGCGGTATTCGGTACCTACCGTTTCCAGCTTTA
CCGCGTGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGGTGGGCTAATTTGCGGGCATACCCCTCTTTCACTCGATCCAAATAAAGCCA
CACCTGCGATCCCACTTGGATTTGATGTGGACGGGCATCTTCGTTGTGTCGATCCGCTCGACCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGAT
CTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTCCTCTTCTTGGTGCTGCAAACTGGGATGGCCGCTTCCAGGGTGG
ATTTGGGATCCCACCCATGTACCAAGTAAAATGATGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGAAGCCGCTCTGCGTACTCATC
CCAATCCTTCTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATTGTCTGCACCATGCGCTCGGCCGATCCGTTAGCTTGGGGACGATATGCC
ATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTC
CAAATCATCGGAAAACGCACTCCTCGTACGATTCAGCAATGGTTTGCGCAGTTCTAGACGTACTAGCTTTGGCTATCACGTATCCGGTAAACAAATCCAC
CCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCA
GGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACGCATTCACCGACATATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGA
AACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAGGCTAGCATGGTAGTGGTGTAGGACACCCCTGTTGTCATGGTGTTC
TGGTAATCACCCCTCTCCATTCATTCCCATCCCCGGTCCTCGCTGTAATTCTCTTTCTTAGGGGGGGCAATAAAAGAGACAAGTCATTCCAATCACTGCG
TAAATCGTAGCGATAATACTGTAGGATTTGGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCCT
CGTTCTATGCTTTGAGGATCCGCTCAATGCGGACTCTCTTCACAAATGTTTCCTCGAGGATCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGAC
GGCCATCACCTGGACTGTCCTTTTCCCGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACT
TCAACACCACATTGATTCCGTAAAGCGGCACTGGCCAAACTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCAC
GCAGGTGGATCATTACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCTCCCAC
AAATCACCAGCCTTTTTGGATCTTGTCCTTTTGGTAGATCCAAACCCAGCAGGAGCCCGTTATACTCCGCTTCATTGATGGTGAGGCCCTCCGCATAAGT
GGATCTGGCCCGCACAGCTTCCCATCCGGGCAGTCTCCACAGTATTGCGCTGTATGCTCCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGG
ACGTACAGATCCTCATCCACTTGTTTCGTCGGGATCGGGGTTTGGATCCGGCGTTTTGGGCTCTTTCTTATGAGCGATCCTAGTCAGCGCCTCATCCATC
TTAGCTCGAGGTGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACGATCTCCAGTGTCCAAGGCGAGAGTAATGCTT
CCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGCGTGTCGAGTCAGGATCCGGATGGGTCTTCCCACCAGCAGGTT
GTAATTGAGATCCAACACGCGCAGGAGCGCGAGTATCGCCTTCTCCACCGCTCCGTAGTTCAGTTCATTTGGCTTTAGCGTCCGGCTGACCAAGGTGACT
TGGATGACAGATCCCTTCATGTTCTTGTACCAAGGCTGCTGAGACTGCCCAGTCACTGGCATAAACTATCACCGTAGGTTGACGTTCCGGATCGAAATGG
CGGAGGATGGGCGTAGTCGCGATCCTGTTCCTTAGCTCCACGAATGCGTGTTGAGCTCGAATCCCACGGAGACCCCCCCTTTTTCGAAATTTAGTATGCG
TTTTTTCTATCTCACAATAGAGATTCCTCTTTTCCCCTTGGTCCCCCCGGGGAGGTACCCCACCCCCCTTTTTAAAATTTCTTTTTTGGGGGGTCTCCCC
GGCGTGGTACCACTTGGATCCCTTCGTGGATCCGATATCGCCAGGGCCAGAGCTTGATGGATTTTGATCCGGACAGCCGAAGTGGCCATCGCAGCAAAAT
CCACCTCCCTCAATTCATAGAGTACTGAAGCAAACAGTGCGTAATCCTCGATGAACCGACTGTAGTAGTTTAAACTGCCCAAGAAGAATTAGAAGGATTG
CATCGCCCGTAACGACAGTGGGAAGGACAAGTCTGCCAACGAAGACAGGTCCTTAAAATTCGCCTACAATCCCAACCTTGGAGACTCGATGACCTAAGTA
ATCCACCTTGCG